Description :
From Genome Similarity Track
Location :
Scaffold_1098:2162- 3706
Sequence
1544 bases(100 bases per row)
TCCACATTTGGATCATGCTCATCGAGCAAGTTGTTTCAAAACAACTATGCGTCTATCTAGACGCTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCAC
CTGCTTCCTTCGGGACCATGTCCCTATCATCACGAGATCTCTCCACCTCCTGCTTCCGCTGCGAGCACCGCTCATACGGCTGCGGCCACTGGTCAGAGCC
TGAGCTCGACTACTGATCTAATAGCTCCCCACTCTAGTGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGATGTG
CCCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTCCACTTCACTAA
GTACTGGGTACGACCCTGGCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCC
TCAGCTGGGCTCTCGCGGGGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACGACGCCGGCGTCCACGACGCGAACGTTCACCGCCCATCGGTC
GATCTCGAAGAGATGATCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGCTGCTCGGCTGAACG
TTCAGCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACCTGTGGCTCTGCCACATGCTGTTGATCAGCCATCTGTGGATCCACCACTTGCTGT
CGTTCAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGCCCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTT
GGTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGACCTTGAA
CGGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCACCGACCTCA
AACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTTTGCGTGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTCAGTC
TCAAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCACCAAGCCCTGATCCACTGCG
TGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCATGCACTGCATTATTTAATGCGAGCTCAACG
AGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCT
GCGGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACT