Description :
From Genome Similarity Track
Location :
contig_60:216187- 238609
Transcript NameFunction/comments
g9093.t1hypothetical protein PHYSODRAFT_552348
g9094.t1hypothetical protein
g9095.t1hypothetical protein PHYSODRAFT_469149
g9096.t1hypothetical protein PHYSODRAFT_294124
g9097.t1hypothetical protein
g9098.t1conserved hypothetical protein
g9099.t1hypothetical protein

Sequence
22422 bases(100 bases per row)
GCTTTCACGATCCGGATAAATGTTCTCTGGATTTTTACTCATCCTCTACTTTTATCCGGACAAAAGAGATCTTCAAACTGAGATCTTCACTTTCCAAGCA
GCCACGAACCCGTCAAGTCTCGCTGCCCCACCATCGCAATGTCGAACGAGCTCTTCCCATCAGCGCACTCCAATACTCCATGCTCCTCCGCGCCGCCTCC
GCCGCCACTTTTCCGGTCTACGGGGGACCTGGAGAAGTTGATTTCGCCGCATTTCGTGGCCCCGGAGGCGCGGCTGAAGCCCATTCCGACCAACGAGTGG
TGGGGCAACTTGCTGGCGTGGGACGGGAAGCGGGAGAGCGACGCCGTGTTCGCGGGGCCGTACACGTACAAGGTGGTGCAGGGCCAGGCTGGAGCCATTG
GTAGCGGCCTCTCGGTCAGCTACTTGCTGCAGTACCGCACGGACGGCCCCATCAACGACAATGGAGCTCCTCGCTTCTACTTCTACCCGCCGACTATCAA
GAACTGGATCTTCTCTGCTGTGGAACTGGCGGAGCAATCGGGTACAGCCCCTCTTAGTATCCAAGATTGGGACGATATGGGGGTGCGTCTCGCCATGGCA
GGCATGAACATGTACTTGGCCTTGGGCACCGCCTTCACGACGGTGGAGTATCAGGACATGCAGGTGCAACTTGGCACCGATCATTGCATTGTCGCTATCG
ATGGAGCCCCGGCTAGAGAGGGGCACCAGGTGAACGGAATCAGTTTTGTAGTCTCACTGAATAACGGACAACAGTGGGTGCTCTACTTCTTTTCGAACGC
TGGGGGCAACACCTCGCTGGTGTTCAAGGACAACAAGCTCACGACTACGTCGAAGTTCACGGGAGTCGTGCAGGCGGCGTTTGTGTCGACAAGTGCCGTG
CAACCTGCGGTGCCGCAGGACGACCACAAGATCCTGCAACTTTACCATGCAAGTGCAGGGGTCTACCCGAGAGGAGTCTCCGTCCAGACGTTCGATTCTG
AGTCGTTTGCTTTCAACTGGCAACTTGTGAGAGCCGCAGGCAGCAACCCGGGTGCACGGTTCCTGCACTTTGCACTCACACACCTTCAGGCGATGCTGGA
TCCGTCTACTGCTGAAGCTAAGCACGAGCTTACACTGCACTCGCATACTCATGGACCCCTGTTTGCGTACGCGTTGGTATCTCCGCCAGATTCTAATCCA
ACGTGGCTGTGCCACGTGCTGCAGGCTGAAAGCAAGGGCATCGAGACGTGCACTGCATTTTACCCACCTCATGCCGGCTCGATCACGCGTGAGGTGGTGG
AGAAGCTGAACTTGTGCCGAGTCGTCACAGATGAAATTCATGGGGATTGGTCTTTGCCTCGTGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTGCAGAA
GTTTGGCTCCATGTGTCTTGTTGCGCAGCAGCTTGCTGACACAACCAACCCAGAAATGAGGGAAGTGGCTCAACATGGCATTTCCAAGCTGCAGAAGTTG
TTGGCGGACTTTGTGAACAATCAATCAGCGTTCCCACTTGTCTACGACACAGTGTACAAGGGAATTATTTCCAGCGAAGCCATGGCTAAGAACGACATGA
ATGTCGATTTCGGCAACAGTGTGTACAACGATCACCACTATCACTACGGCTACATTGTGGCCGCGGCCGCCATGGCCCTCTACTTGGATGCGACGTGGCG
TCATTCAGCCGATGCTGTCAAGGTGCGCACATTCATTGACACGCTGATCCGGGACGTTGCTACCTCGTCGCCTGCCGGAAGTGACCCGTACTTCCCGCGC
TACCGCTACTTCAACTGGTGGCTAGGTCACTCGTACTCACACGGTGTGACTCCAATGGCCGATGGCAAGGACGAAGAGTCAACGTCGGAAGAGGTTAACA
TTCTCTACGGCATTGCACTGTACGGCAAGTGACGGAGAATACCGAGCAGGAAGCGCTGGCAAAGCTGATACTGAAGGTCTATGTGCGTGCGGTGAACACA
TACTTCTTGTTGCAAAATACTGGACCTAAAATCCATCCGGCGGGCTTTTCAAAGAACAAGGTGACGGGTGTTTTCTTCGATAACAAGTGCGACTACGCAA
CGTGGTTCAGCCCCAACAAGGAGTGCATTCACGGCATCCAAATGATTCCTGTTTCGCCGATTCTCGAAGTCTCTCGAGCACCGAGCTTCGTGCGCGAAGA
ATGGGACGAAGTGCTCAGCAAACTGCCGATCGTACACGACTGGAAGGCGAATCAATCTGGCTGGACCTCGCTGCTATTTGCAAATTACAGCGTTCTTGAT
CGAACCAAGGCTTTGGAGGTGCTATCCCAGTGCCCGATGGACGATGGACTCAGCCGTGCTTGGGCCCTGTACTACGCAGCCACCCGGCCGTCACCCCCCT
GCTACTAGCAGGCTGCTAGTCGAACCTCGCACGCAGCTAACCCAGTCAAATAAGTCTCGTGTTTCGACCCCCCATTCCATTAGCCACAAATCGCATCTCT
ATCTGTTCATCAAAACTGTTGCACCTCTTGTGGTTTGCCTCTATCATCATGAAGAAGTCATCGCTTGTAGCAGGGATTGAGCCAAGTTGCTTACAGCAGG
CGACACTTGTCGGTCACGTAGCGAAATTAAACAACTGCAAGCCGTGAACGGGTTAGACGATGCAATAAATATGTAATCAGCTGAGCTCGTACCTGTCGAT
GAGACGTTGAAGCTCTGCTGGGGGCAGTGCTCCAATAAAGGCAGGTAGTTTTCCGACGAGGGCCCCCACCACCTTTAGTCCGCTCATTGCAACGGACTCA
CTTTGGGTGACCTCAAGACGAGCTGCAGCTATCTCGAAACAGATGCGAACAAGCTGCAGATCGGCGTTGTTTTCCATGGAGAGCAATTCGCTGGCCTTAT
ACAAAAATGCAAAGATGACCTGTAGCAGTAGACACCGCATGAATGAAGATCAGGCGAAAAAACTCAAATGACTTTGGGGGTAATACAGCCATACCTGCAG
CCCGCCAGCAACCACACCGTCTTCTGAGCAATGTCGATGCTAGCGCTACGCGCGAAATGAGTCTCTGTGCTTTCCAGCTAGCGAGCATATTGTTATCGGA
TCGGGAGATGGCACTACCAAAGCAAGCAATAAGTTAGTAGCCCACACGGATAAATCGATGATCATGAGACTGCAATTAAAGTGTACCTGAGTAGAAACGT
TACAGCAACAAACGCGGAGTTGGAGAGGTAGATCACCATGTCGAATTTCACTCCATACGCTAACGAAAAGCGTTTGCACGCGCGAGCCAAGCGTCTTGTG
GTCGTCGTCCGTAACGTGGGGTTCATCCTTCGTGCCCCCGAAAATCCAAACTACGAGAAGGTTCAAAAGTGACGAGCCATCCGCTGTAGGCAATTTCGTA
CTGTCTTGCTCGCATTCATCTTCAGTAAGTCTGGTGAGAATTGACGCGATGCAATCAATGCACCCGCGCTGGAGATCAATGAGCAGTGATTCATCCATTG
CGAAGCTTGAACCCGGAGCACACGGGATCCCAGGATTTTGACCAGCACGACAAGTGCTTTCGAAGTGATATCTCCGTTATACATGTCCTCTGAAAACACC
CGATTCAGGTAGTAGACCATTAGCTTGGCCGTCACTAGCCCACATACATCCGGAACGATTTCTTCACTAACGATCAGGGAACTATTTTGCTCGTGGTGAG
GTGTTGCCTCCCGCAGGAAAGCAATCAGATACGCGAACGCGAAGGGTAACACAAGAGGCGGAGGGAATTTAGCTAGTCCCTCCGTAGCGAGCATCTTTAC
CTCCTTGAATTCCAGTGGATCCACAACGGAGAAGGCTAGGATGTGAAACAAACGTTCGTTTGTGACATCTCCATCGCTTTCTGGGGCTGTCGCTGGATCA
TTATATCGCTGATGGTCGATATACTCGTTCAGGTGGTCTAAATCTTCGCGCCCACACTGTATCACACAACCACATCAAGTTAATATCAACCTGGGAAAAC
AGCGTACAGGAGAAGTTGCTCACCGCCAGCGTCGTAGCACAGTTATATCCAAATATCTGTCGCGGAAGCATACGTAGCACCAAAAACGGGGCCAACCGAG
AAAACAATAGCCCCTCCGTAGCTTTAGCAGCCGAGGAGGATGTGTCGTCAAGTAGGTCTTCACTTAAACGCTGCAAATTCTGCAGCATCAAGTTTCAAAC
ACATCGATTAGAATTGGGTACAGCTATTTAGTGCTTGCGGCATCGCTCGAAGTTTACCATCATGTGAGCGGTAAGCTGCTTTCCCATCGTCTGAAATACA
GCTTCGTCCACCCAACCACACGCCACAAATTGCCGTAGCATCCGGAAAAGTAGCGTATCACGAGGAGAGCCAAAGATTTTGCGAAGGAGAACGCTTAAGA
CCTTGCTGCGGGCATTTGCGAACTGAACGTACTTGTTCCACCTGCGCAGCCACACATAGAGCAGCGGTATATTTTAAAAGAGGAACACGGCATCGGATCA
ATACAGCGATGCTCCTACGTACCCGTTTGGACCAAAGCACAGCAAGAGTAACTTTTCTTGTAGCTCTTCTAGCCCATTGTTATCTTTGGTGTTCCCTTTT
AGTAAGAATCGTATTCGTTCCAATAACGGGGAGATCCAGGGGCTTCCGACGAGACCTTCGATGTCTGAAGGCCCCCAGACTGACAAGCATCAACGAACCA
TGTCACCCTGGTTTCCAGCGAATATTGCGACGATGTCGCGAAAAAATACCCAAGCACCGATGTCACTATGAGGTTTTCAGTGTCGTGAACACCAGCTGCA
CACAATCCCGCAATACATGACATAGGGTCCAGCGACGGTAAGCAAGAAAGTGCCTAGAGACAAGTAATATGTTAGTCTCCATTTTAAAGAGGAACATGTG
CACCACACGATGCAGATAGTCTTACCAATCGCCGAACATGATCATTTTCGTTGTCAATGAGACCTAACAGTACCGGTGTAAGCTGGCGCCTGTTCATACA
GGAATACGGCGGTGAAATCTTCGTTAGCTTCATTATGAGCACAGGGACCATTAATGTTGTCAGCAAGACTCCTACCGCCAGTGTCGATAGAGCGGCACTT
GAGTGTCTGCACCGTCCAGTTGGTAAATGAATGTGCGCACGAGAGAAATGATTTTCTACACAACAGACAAAGTGCACAGCAAAGCAAACATATTGTTAGC
ATTGCAAAAAATTGCATCAAACATTTAGGGAACAACAATGTGCTCACCCGAATTCTTCGAATGTGAAAATCTTGCAGGTTCACTACGATCTCCGTGATGA
ACAGTTCTCTCGATATGATGAAATCTGCCACAAACAACTCGAGTTCCGTTTGATCTTGTGATCCATTTGCAGTGAACCCTGAGTGAACAGGAACTGCCAA
TTCGTTGTCGCAAAGACGAAGTAACTGCGAAAGAAGCTCTTGTTCGTCGTCGTGCGTGGCTAAAAGACCGAATGCATCACTGGGCAAAAGTACACTTCGC
AGAACTTTGAGGATGAAACAAACTGCTGCTTCATCACCTTTCTTGATTGCTGTAGCCATCCCTCTGACGAAAATGAAAACGAAGTACTGTTTCGTTTCGG
TTGATAAGCTCTTGAATGCTTGCGAGCATCCTTTGACACCACCAATAGAGTCCAGCAATATGCAGATGTAGCGAAGTTGGGCATACAGCACTTCACGATT
GGTTGTGTCGCGATCAGTATTTGGTTTGATGTCCAAAACGCTCAAAATCCACCTCTTCAGAGCTCGAGATAGAACTTCGGACGGCTGATTGTTTTGAATT
TGAGACGATGCTTCACTACGCGTACACAGCAGTGAGGCGGTTGCCTCCCAGTGCCAGCACATCATATCCAGCACCACTACCTCATTTAAATCTGATCCAG
TTGCGGCCTCCCCATGCTTGGATAATAAAAGCGCATCGCACGCTGTAGCGTACCATTGGAGGTGCTGGAGTGCATAGCTGAGGAACTCACGTCGTGTTGA
GTCTAGATGCCACTGCCGTAACACGGTTAGGAAAAACCGCACGCCTGTCACCATTTTGTGCATCAACTCCTTGCTGGCATAACTTCTCTTTGTTGCTTCG
TCCGACATCAAATAAATCGCAGCAATGTCTCCACACAGTAGCGCAAGTGCTTCCAGGGCAATCAACGCAAGTTTGGACAGCTTCACACGCTGCGAATCAG
CAACACGACGTACTCCTCGCTCAATAATACCACGCAGAGCATCCATGTACGCTTCAGCTCGATCACCCAGCAGAAACGGGCATTCGCTTCCAGAAACAAC
AGTCATCATCTTCCGACGACGTCGTTGTAGCAACTCGAAAAGTGCAAGACAAGCAGCCAGCTGATTCTGCTTCTCGGCTATCGGCTGGATCCAATCCAAC
AGAAGCTCCCGCACAAAGTCATGACTCAAACTCGCAACGGCGCACTCACGATTCACCATCCAGTTCAGCAAAACATGCAGTTTTTCCGCCTGCGGGCCCC
AAATGCAGCAGTTGGTACGAGACGCCGTGCAATCTCGCGTCGCCTGCATAATTGCGGCTGCAGCTACAGCACACACCAAGTTTCGGTTCTGCGCAGTTGT
CCCAACCTCATTTCCAACTTCATAAGCGTCCGCAACCGTCGACTGCAATGTACCACCAACCAACAATGAGTCAATTTCTACCATTTACAGCTTCTCACAA
CAGTTAAAACGCACCAAAGCAGCTTGCAACCGTGCAATCCGCTTGTGGTCCGACAGCGACAGCACTCGACCCTGCACAGTCAATTTCTCCAATGAGTGAG
GCCACCCGCACCACTATCAGCACTACAGTGCATTGTTCAGCCCTAATTGACACCTCTCCAGTGCGTTCCAGCACGTCAACGTCGTCACTGCCACTGGGTT
TGAGTAAGGACTCAGATCTGATTCCATTCTTCACCCGGTCCAGACTTGTGATTGCCGCCTCCATCTACGCATCCACAAGGATTAACTTGCACGATTATAA
TAGATAAAGGGGAGAGTATAAATTTACTGTAGACATACGTGGAAGAGCTCACAGTCCTGTAGCACTCGCAGCAGCCGCCCGCGCTGTCGCGATCGCGAGT
TCCGGCCGCCATTTTTTTCGTCTTGTCAATTCAGTCACGGTACACTAATCCAGTGTGGTGCACAAAAATATACATATGGCTACAGCTGTGAAGAAGGGAC
GGCTACAGTTGAAGCAGCAAAGGATACAGTTGAAAGACACTGGTTGAGCCATTAGCACATGCATTTTCTCATTCGATCGAGATGGTACCAACTCCATTTA
TACATACAGAGCTAGAGCTGGTGGCTTCCTATCACTCGGAAGGTCGTGGTCCTGTCCTGTCGACTGAGGCTTTACAGCGTCAGGGTGTTGGGGTCGTCTT
GGCGGACTTTGTCCACGTCATAGTACGTCGCACTGTCGTCGGAGTGAGCGCTCAGGAACGACTGGTTCGAGGACTGGTTCGAGGAAGCTGATCTCCTGCG
GTGCGACGGGTAGTACATGCCGTCGTTCGTGCTGGTGGTGCTCACTTGGCTCTGGGCGTTGAAGTCCACGCGAGATGTAGCGAAGTTGACCCTCGACTGG
TAGCCATACGAATCCACCGAGTCGCGCATCGAGAACGCAGACGAGGTCACACCGAGAGGACCGATCTCGTAGCTCTGGCCTTCTACGTCGTTGGTTTCAC
TTCCTTCCTCCTCAACGCTAACCACGGTCTTAGATCGACTCTTGAACCAGCCGCTGCTGTCACCATCAAAGCTGTTGTCAGAGTCGTTCGAGAAGATCGA
CATCTTGGCCTGAGGACTGCTACCGTAGCCTTTGCTTTTGCTTTGGTTGCTAGGAGCAGCAGCACCCATTGCGGCGGAGAACGTATTGTCTTGCTTCACA
GCCTGTGTCACGTCCGGACTGGTAGCAGCAGATGACACAACCGAGTCCGAGAAGTTCACGTAGGACTGCTCCATAGGAGCATACGAACTGGCCGAGGAAG
CTGCGGGGTAAAGCGCTGACCCATAGTCGATGCTCCAGGAGCAAACTGCCGGCGTGCCATTGAGGGTGCTGGCTGCGCGGCTACGACGTCTCCGTCAACA
TCCACGTCGTCGATATCCACATCCTTGTGCAGATCGTCCAAATTGAAGCTGTGCTTCCTTCGCGAAGACGAACTACTGATACCAGAGTCCGTACCGGAGA
AAGTGCTGACATAAGCGTCGAGGGGCACAGTCGATGGACGTGAGCCGAGACCAGAACCTGACATCCCCGTTGCGATCGAAGCACCTCCTCTTGAAGACTG
GCCTCGCGATGACGGAGGGCCTCTCGATGACGATAGACCTCCGGCCACGTGTTGGCCCCTCGACGAGTTCTGTCCTCGTGACGATTCTGCCTCTTGAAGA
CTGTCCTCTCGACGATTTAGGTGACGTTGAGTGTCCCGCTTCATCGTCCGTATTCTTCGTACCAAGGTACGCTGACAGCACATCGTACGTCGGAATTGGT
GCCTCGGGGATGGGAGCAGCAGCAGGGGCAAGCGCTGCATTGCTGATCGCAAAATCATCAGCGCTTTGCGTCGAGTCTCCAAACGAGTACTGTTGGTTAC
GAGAAACGGGTGGGCGAATCTTGCCTTTAGAGCGACTGAAAACCGGAGCAGGCTCCGGGGCCGGCTCCAGCATAGGCACGTGCTCTGAATGACCACTGCG
AGAACTCTGTGTAGTACTGTAGCCAGACATCGCGCTCGTCTGCGACTGGTACTGTTGCGGTTGATACTGTGGTTGCTGGTCAAGCTGTTGCTGCTGCTGT
TGTTGCTTATTCTCATACCAGTCCACGCCGCGGCCTGCTGGGGTAGTCTCAACTTGCTCGTAGTTGCGAGCGTTGGTGGACGTGTGGTTGCCGAACTCGA
GGTTGATGTCGGTGGCGTCCAGGCTGGAATTTTCCTTGCCATCCTTCTTGTGACGACAAGCAACGATCATCTTGTGGATGATCGTGTACGCTTGACGCAC
GAATAATAGGAGGAAGATGAACATGTTCACACCGATGATGCCGTACGCCACATTGTCGCGCACAGTCTGCGGGAAGTAGTCATCTCTTGCCACGATGAGC
ATGAGGCAAATGAGAACGACCTTCATGAACACGGACGTAATGCCGATGTAGTACAAGAACCGCAGCAAGTTCGGCTGACGAATTAGCAGCAGGATCAGGT
ACACCATTGTGATTGCCAGGATGCACAACAGTTGGGTCGTGGCATCCCGAACAACGCCGACGATGGCGCCGGTGAGCACTGCCAGCAGAATACGGGGGAT
GAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGCTGCTGAACGCTCGCTGGTCATGCTCGTACGTTCCGACGTCCTTGAGC
TCGTCGGTGTTGTTGCCAACGACGATAATACCAAGTCCAAGAGCGCACAGCACAACAGCGACAAGTGCAACGATGCCGAGTGCGAAGCGCGAGCTAGAAC
CGCTTGCTGAGTCGTTCGACGACCCCTCCGAGATGAAATAGCTTCCTGCCATGGCAAACATGTACTGCGCTAGCAGCAGCGCCAGCACGCCGGCCCAAAC
GACCTTCCGATACCACTTGCGCGCCACGTCACCGAACGATTCGTTCTTGGCCAAGGCGCCCGTTATCAGTACGATCACCAGGTACAGAGCGTGCATCGCC
GCGACTACGATGACAAACGTCACGAGCGTGTAGAAGAAGAGGTCGTCTGCGTCACGCCGATGAGAGCCGAATATCTCGCCGGGCCTGACTCTCCAGCAGC
CGCGACGATGCCCGTCGAGCCTGAACCTGAGTCCGCGAGTCTTCTTGTGCCATTGGTACTGCTGCTGGAGTCGTCACTGCTCCCCTTAATCAGGTTAAAG
TTGGTCCACGAGAGTTCCTTGGAGAACTGCAACAAGAATGTCGGCGCTCCCTCGATCCGGAGCTGGCTGATCATGCCTGCGAACTGTGCCTGCTCCACGA
TGTGCGTCATCTCGTAGAAGCCTCCAGAGAAGCTCAGCGCCGCTGCAGCACTGGGCATTATCGAAGCCCAGAGCATCGAGCCCGTGCCAATCACAGCGGC
GCCCGCCAGCGAAGTAGCAATGACGCCCGAGGCCGTGGTGCCGGCCTGCGAGTCCAGGAAGTGCCGCGTGCCCGTGGAGTTGGTGGGCCACTGCGTGTTA
CTGCCGAAAACACATCCGGAGCACGAGTTGGCCTCGACGTAGCTGGCGTTCAGGGCGCCGAGGTCCACGTCCGAGGCGAGGTGGAGCGCCTGGCGGATCT
GCTCCTCGCCCCACGGGATGGCGTACGTGTAGAAGAGCAGGCCGAGCGCGGCCAGGAAGGCGAGTGGCAGCAGCAGCGCGCAGAGCTGCGAGATCGCCAT
GCAGCCGCAGCATTTGGCGGCGCAGCACAACAGCCCCATGACTACCGGTAGCTTCGGGGTGGCGGGTGGATTACCAGTATACGAGGGCGGCGCTCGTGGT
GGTGGACCTGCTGAAGCGGAACTGGCTGCCGTTGATGCGCTTGCCTCGGTGGATGCAGAGGCGAGGGGAAGAGCCTGTAAGACTCGCCCAATGCACAAAA
GTCGGATGGGACGCGAGGTTAGAGACCCGTGTCAAAGTGCAAGTGTTCAGCTCGAACAGCTCAATCAGCTCTCTTCAATATTGACCAATGGAAGCACGCG
AAAACGATTCAGACCGTTTCGGTGAGTGCACTTTCGACCAATGGGAGTATGAGACAGGGGTTGTCAAAACAACCGTACATGGAGGCTTCTAGCACGTGCA
TGGCACGACATTTGTTGGCGCGAAGAAGGCTTCCACTGCATGTACTACATGTAACAGAATCCTTCTTCGTCCTTTGGACAGTGTGTTGAGCGTGCTGGTT
GCAGGCTCTGATAATCGAAAAGCACGATCGTTTGACGTACGTGATAGGATACATATACGGTAGCTTTCTGTGCGGACTTTTACTCGAAACCACTTCTCTT
CTACCGAGAGCGGAGTTTGCTTTGTGTTGGTGAGTCTCCTTTGCGTAGCTTTCCTGGGCGATGTGGGGGTGAAGAATACATGTACGAAGCACGCTGACGG
CGAGAAAAAATATACCGCGCTTCGACAACGTCATGTCATGCGGCGACGATGCTTTGACTTTGATTGGTACCTATGTGGTTTACACAATGCGATGTTCTAA
ATGTACGTTTATCCATCAAACCCGTTTCTAAACTCATTCGATCGTTTCTAAAATAGACTATGGCCAGCGCGACGCACCCGTTTGAATGGTACGGCCGTGC
ACCGACGCCCCTAGCGCTCGCTCCGTGCCGCCTTCTCCCGCTTATCAAAGTTGACATTGCTCTACCCGTTCTCTTCTTCCCAGCGAAGTCAGTCTCTCGT
TCCCCGCGGCTGTGGACGCGCAGTACGTGTTGCAGACGCTCGAGGTCGACGATGAGCTGCAGCCCGACAAAATCCACCGCACACTGACCGTCAAGGGCAC
AGAGCTCCACGTGTACGTATGAGGCTATTGATTCCGTCTTTGTCTGAGGTTACTTTGTGGTCTATTGGTGCTGACTTGTTTGTTGTTTGTTGTTTGTTGT
GCGGCCGTTTGGTTGGTGGTGGTGCGCTGCAGCCACTTCGAGGCCACGGAAATCCGACTGCTGCGCGCCGCCGTGTCTTCGTTCTACGACATGGGCGTGC
TTGCCGCACGCACGCTGCTGGAGTTTAAGGAGTAACCGAGGCAAGAGGAATAAAGTACTACGTCTGGGTTGACCAAATCCGTTTCGGCCCATTGGGAACT
GCTCCATCATGCCCGATCCACGCATCAAGTGCTGACAGGCGTCACTGCTTGACCATGGCAGCAACGAGTTAACCTCATTTTCCGTTAGCAACGACTTGGC
GCGTTAATTTAACTGCTGGTGAGGCATCTTCAAACGGCAGGCCAGGAGTCTGGTTCGTTTCGACAGACGGTTTGGTTCGCAGCAACACCCCTGAGTATCT
GGTAGAAGCTTCCAGCAAGTGGAGCGCCTCTCTAGTGTGGCCACGCGAATTCACTCAACCGTGCGATAATGCATCGTATCACTGCGAGCAATTGCTATCT
GGAGCAGCGGTTGGACATTCCATTCTGCTAGTCGCGGGAGCTCGAAGACACAGAATCAAAATGTCAAGTGTAGCAGCTCGTGAAAGTGGTTCTGGTGACG
AGCATAGCGTATCAAGCGTATCAAGCGGGGGTCAATTGCTGCGGGATGGAGTCCATCTGATGGACCGTTGTCCACTACAACACAGTGCTGGCACCTGCGA
CAGATGCAAGCAGAGAGGATGGATTTTACTTGTAGAGCAGGAGAGGATGGCTTGAGGTTTGCTTGCTTTTGGGATGCGAGCCGACACCGATTGCTCTTCG
CCGTGTAGTGTGGGTCTCTGTACTTGATCACTGCTGTCCCACGCCGAGACTACTGTATAGGGGGCGGACAAATCCAAAGGCTCGCCCCAAACGCTGCTTT
GAAGCACAGCGGCGGTCAACTTCCCGACATGAAAGGACGACCGCAACTTTGCTGGGGAAAGCATGGTGGGGGCTAGTGCTCCAACGCGATGACTTCCGTT
GATTCCGTTGGTCTCGAGGCTCGGTGACGTTAAGCGCGTAGTGAGCGCTGGTTTCGCGGTTTTTAGCCGGTTTCCGGTCTCGTAACGGGGCCAACAACTC
CATGCAGCATTTACGCTTCATTTCTCCGGACGCAGAACTATTCCTTCCGGTTGCTCTGGCCTCACAGCCAAGTGAACCCCATGGGAAGCACCACACAGCT
CCATCTCACAACTCAGGTATGGGTGCAGTTGAGACGGAGATTGCCAACTTGGAAGCGATCGCCGTTACCAGGGGAAAGCAAAAGCAGTCGGCAACGCAGA
CAAATGTCCTCGTGGTTGGAAGGGGGGGGGCTGCGTGGCAATCGTCCTCGGCCGCTGCCGCTGGGTGTCGTGCACATGCGGACGGGGCTGGAGACGATTA
TCATCTTTAACCCTTTCACTCGCAGCGCGCCACGTTGTTCACTGAACCTTACGAGATTCGCAAGGTGTATGTACATACAACGCTGGGTGTCTGGATCCCA
GCGGTGGTTGGAATGTGACCTGCCACATGGGACTTCCGAAACAACCGAAGCCATCGCTAATACCTGTACCCAACAGGCGCCCGCAGCAAAACCATGTCGA
GACGACCAAGCAGCTGCCGTTTTTCTGAAGCCGTTGTGTGTAACGTGCAAGTTGTCGGCAACTTGTGTCACCGAGACACGGGCATAGCCAGCCGTCGATG
TCCAGCAGGCGGGTTTCTGGGCTGTGCCCAACGTCCCTCTCCTGCTTATCCTAGCGAGTTGAGGTCAGCGTGGCGGCAGTCTTTCATCACTCGCCAATCC
GCCCGCTTCCAGAGATTCACCGTCCACCTCGGGCTGAAGCATGCCGTCCCTCTTCGTTGACGAGCTGGCTGTTGACACCCGAGAGCTCGTGGAGCGGCAC
GTGGCCGAGTCGTTCGCGAGCCACCGCCCCGTGTCCTTCGACGACGCGTTGTCCCGCTCGCATCACACGTTGCGCGGTCGCAACTCCATGCCGGCAGTGC
TGCGACTGTCGTCGGACTTGGGCTCCAGCCGCCTCTCGAGCTTCGGCAACATCCCCGGCCACGAGGTCATCGAGACGTCGGTCCGCTTCGTGGGCGTCAC
CCGAGTGTCCACCCATTGCGAGTTCCGGCTACACGTGGACACTGGCAAGGAGAACTTCGTGCTGCAGAAGCGCTACTCGCAGTTCCGCGACCTGCGCCAG
CAGTTGCTGCTGGACGGCAAGTCTGCTGCAGCGGGTGAGAAGGGACGCAGCGGCCAGTGCCGCAGTGGAGCGTGTCTGCAGCTCGCGCAGCAACTCGCCT
TGCTCAAGTTTCCTCGACGCAAGATGAAGTTCAAGCTGCACCGGGACGACGACGTCCGCATTGCAAGAGAACGCCAGGCTCAACTGCAAAACTTCGTCGA
GATGGTGCTGGCAGTGTACCGCATGGCGCCCAAGCGGCAGGTGCGTTGCTGCGTCAACTCGCAGTGTCGAGTGCTCAAGGCTATTCGATCCTTTCTAGAC
ATTAAGGATTTGGGCGAGGACCTGGTTCCGGACTGGAAGTCGGTCAGCAATGGCAGTAGCACCGGTGGTGACGTGCCGATTCTGGACACGCCGCCGTCGA
CAGGGGGACCAACCCGTCACCAGTTAGCACGTCGTCCAGCGATGCTGCTGGCTCAAACGGCTCGCCGATCCCCGCGAGGACGTCGGCCATGTGCTTGGAG
GAACTGTACACGATCACAGAAGACACCGAGCACGCCTTCGTCTAGACGATGTAGCACGACATAAGGACGGATGCAGTCCTAGCGTCGTGGACGCGACAAC
CAACCAACTCACCAGTCGCCATCTGTAGTAACTTATTTGCTTCGTTTGTAGCACCCGCTCCATCGGTAATTCAAGAAGATGTAGCAATGGAATCCCATTA
ATTTACCTTTGCACGTGAACACCTTTGTTCGAGTTTAGTGTTCCACACCTTTAGCCTTGAGCAATTCTACGATCACTGTTGAGACTTTGTCCTCGTCGTT
GCTCAGCCCGCCCATGATCTGCGAGGTCTTGCCCCACTGGACGTTGCTCACGAGAGCCTACAACCAGCAACAGCAGGTGTGTCCGTTAGCTCAGTTGTGC
TTCCTGTATCCGTTAATCGAAAGCGTCCAACCAGTTGATCAGTTACCTGCTCATGTTTGTTGTCAGTGGTGCCCCGGCCACTCAGACTCGTGTTGTCGCT
GTCCCCGGCGCGCTGTCGCGCCCACTTCATCAAGTTGTGATTTCATGGACATACCAGCACCCGATAATGTAAGACATGCCAAACTCCTCATCTGAAAAGC
ATGAAGTACGTACGCTTCGCCAGCTACTATCGTTTCCACGCGAACGACGCGGAGAGGGTTTTGGTTTGTCGATTATTGGCTTTTGCGCTCGTCGTAGTTG
GCCACAGGAGACGCCCGGAACGCCTCGCTCGGTTTGAGCTCCTCTGCCAGACGTCGGTGATAATGGCAGCTTTGGCAGACAGAAGTTCGGCTCGCGTACT
GATCGATAGCAACCAAGATCTGGTCGTGGTCCCATGGTTGGAATGTGCTCTTCCTCGTGTCTAGTGAGAACAGTGTCCACCAACTCTTGTTTGTACTGGT
TCCACCTCGCCTCCCTCCGCAAGTCTCGCGTGACGCTGGAAGTATCAGCACGCGCTGAAAGACCAATGACTTCCTGGCGCAGCATTTGCTCGGTGGTCGC
GTCCTTCAGCACAATTTGTCGGAAATCCACGCGGTCGACACGATACAAAGTGGCCGTCGGTGAGGAAACCAAGACCGAAAACACCGCGTTCGTCACACCA
AGGGTAGCCTCGTAAAAGCCAAAGTAGTGCTGACTTCACAAAACGCAGTGCGAGGGTCAGTATGTTAGATAAGCTTCGCGTCGAGAAGCGGTATTACTAC
CTGCAGACGGTCGATATTTCAACAATGCATGGCTGCTTGCGGCTGTCGTGCTTCTTCTGGTCGAAGGCCGAGTAGCGTTTGACCAGCCTGCACTCACCAT
GCTTGATGAAATAGAAGTTATCTTCGGACGAGAACCAGCGGAGTTCAGATCAAAGGCAACAACAGAAATGAGCATCACGTTTACTTACTTGCAGGTTCGC
CTTCCACAACAATGACATCGTTGTATGTGTGCTGTATCTTCTCCATTCGGTCACACAGCTTCAAGATGCCTTCGTCTTCCCAATGATCCAGGCAGGCCAC
ACCTGCTAAGAATGTCATTTTCTCGCTGGCAGCAAAGACGACAATTTTGCAAGTTAGCTAGTCCACGTGATTGAAAGTTGCGTAAAAGCTCGTACCGGAG
GTCACGCGACAGATTGCACGCGCGTAGTGCCATGAACGTGTCACGATCAATCTGCATGAGCAATGTGGTTTCCGTGGCCACAACCGAAGCGGTACGCTGT
TGCTCTTCAAGGAGCAGGCCAACGTCGCCGAAGACTTCCAGGGGCTTCATCGTGCGCACAATGTACGTAGCATCATGTGACCGATCGATCTTTCCGCCTG
GGTTCAGGAAGCTGGAGTGCACGCGGGCTCGATTCATGATCTCCTCGAACTCGTTCAGCGTTGGGGCTGCCATTCGCGAAAAGTCCATGACGACGCTCAT
CGTTCCATACATGATGCAGTAGAACGCATCTGCACGATCACCGATTCTGAAAAGCGCATCTCCGTCCTCAAGCTCGATGCCTTTGGCGGCCTTCAAGAAC
CGTAGTCGGTCTCTCGGTGGCTGCTCGCGAAAGTACTTGACGCGTTGAACTGTACAGCACAACAGCACAAAGTCAATGCAAATAATGACAAGACGTCGGC
CGTGAAATTATCTGTAGATACACCGCTTGTAACATACTGTATTGATCGAGGAACTCGTAGTCGGCCTTGCATCTCGCCACTTCGGACAGCAGAAGAATTC
GCCTCAAGTTGGCTCGCACCTCCGGAAGTTCGTGGTTTAGCTGCTCCTGCCAGCTCGCCCTCTTCGACAACCTAGCAATGGTCACATCGTGTCACAACAT
ACTACCAATATATGGTACTATCGGCTCTCTGAATGCCAGGCATACGCACATGCTGCGCGGCTTGGCGAGTTCAAGTGGACGACCAAGATGTTGAAGGTAG
TAGCCATTTAAAATTATAAATGGCTACATGTACCTAATATAGGCGTCCTATGCTAGGTTGTCTTATGTCATCCACACTACTTCTGAATCTCTTTTTGTCG
ACCACTTCACTCCCACACAAAGTCGAAAGGTGAGCACGACGTCACATGGACGCATCTGCTGCCTGTTCACGCTTGCGGATGCGCTCCCCAGCGCCGTATC
GCGCGATACAACAACTTCACCACGTATTTATCCCTCTCACATACCTGCTGGTGTCATTTTCACGCAGATTCTCGCCGTCTATCGCTATTAAACTCCCGCC
TAACGAACACCATGGACCCCGAGACCAAGAAAAAGTGTTTGGACGTCGTGGAGCACTTTATCAAGCTCGATAGCTGCGGTGTGTTGCCATTTCTATTGAA
TTAGGCTTTTCCGGACTGGTAGCAATAGACTCACGCTTGTTTCTGTGGCTCCAGAGCCCTTCCGCGAGCGTGTCAACTGGGAGGAATGGGGTCTGTACGA
CTACCTGCAAGTGGTCAAGGAGCCCATGGACCTGGGTACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAACCGGCCGAGTTTGCGCGCGATATG
CGCCTCGTCTGGCACAACTGCAAGCTCTACAACCAGGACGGCTCGGACCTCTATCTGCTGGCCGATGAACTGACCAAAAAGTTCGAGGACCGGGTCAAGA
CCATGAAGCTGGACGTGGGACCGGTCCCCAAAGCGGACAAGAGCATCCCGTACGGTACATTGATGTAGCTTTGATGTTTTAGTTGGTGAGTTTTAACGTG
GTATGTGCTGTTGAGTAGAGCCCCGAGTCTGGAGGAAAAGATTCACTTCAGCCAGAACATCTACAAGATCCCGAGCAAGGATTTGAATGCAATTATCGAG
CTGCTGCAGGAGCAATGCCCCAAGGCGCTGGACAAGAGCTCGCCCGATGAGCTGGACATTGTCGTCGACCACATCGACAACAAGACGTTCCGCGACTTGG
AGAAGTTCGTTCTGGAGAAGGTTCCTGAGGGCAGTCGCGAGCCGATCTCCACGCCCAAGTCGTCGAAGAAGTCTCGACGGCCACCGAGCAAGAAGACGAA
AACCGATCCGTGATCGAAGATGAATGCGTTTTGAGCGTGCCTAATTTGCCTTGACTTGTGTTTCATGCTATGCCACAGCCTTTCTGGATAAAGAAGAAAT
GGCGCGTGTATTTAACCTCATCCAGGCACGCAGTGAAAATCGACCGTCTACTTGGACGGTATGACGGCTTATCAGGGTATTTAGTCATCTTTTAATCCCT
TTACGCTTCTTCCCTGAGTATTGCTGCTCTCATTGCGTTATTTACTTCTTCTTTCGAAGCATAGTTGCAAGCCGTGTCTGCCGTTGGAATGTGGCCTCGA
AGCTCTTTCTCTTCTGCTTTTGTACGGGCTCGTCAGGCTCGTGTCGAACTACGGCAGCTGCTGGCCTACCGCCGAGCCTGGTGAAGTCTAGTGGTGGCAC
AACGATATTCTGCGCTGGTGATGCTTCATCAGAGTCATCTCTTGGCAACCCAAGCTGGACGGGAATTGCTGCTGAAAGGCGAGCCCCTGCCTTGGCTCGA
GTGGATTGCCACTGAGGTGGTATGAACTTAGGTCCATCAGGCTTCAGTGTTGCCCCAGTGCCGTGTGAGGCACTTGGGAGTGGAGCCACTGGCTGCAGTT
TCGGCAGCGGGAGTTGAAACTTTGACGGACGGCGCATCGTTTTCCTCTCGTTCGTCGTGAAATCCCGCGCTGTGTGTTGACGACTCGATTCGGGCTGGTA
TTGGGACGAGCGTTTGTACTCGAGCAGTTCCTCCTTGTGGAGCTCCATCAGCTCTCTAACCACCAGTTGAGAAGGTTGTGAAAGGTAATATCGCGATCTC
AAGAGTACGCGACGACCAGAGAAATGCATATTACCTGAGTGAAGGCTCATTGCTGTTGGCGGTGTTCCAGTTGGTGCCGTGAATCTTCTTGCCGGCTTTC
ATGAGCCTGGTCCATTCCTGCACAGCAAAAAGGTCATGACGCTGGACGATGGAGGCCAAACATGCTCAGCCTTACCTCCTCGTCGTGCCGACTGGTTTCC
ACTCTGGACGTCACGATTTTCGAGTTCGTCATGATATCGCACTGATCCTCTCGAGCAGCGAGCTGCTCTTTAAGCTTGCCGATATATCGTCGAAGATCCT
CCTTACGTCTGCCAAGCTGCTCAAGCACGCCTCTGCTGGACTGTTGAAGTTGCAGTGGCGGGTGATATTCTACATGGAGTTCACGGCAACACTCTCCTGT
TACATGGAGCGAGGTGGTACAAAGTGTTCATTTCTGCGTACGCGTTCGTCGCTTGCGTTTTTGCATCTGCTGCTGGAACAAGCCCAGGACGAGCAACAGT
AGCAGCACGCAGCCGATGATCAAGCCAGGCGTATCGATCTTCGAGCCTGATGTGCCTCGAATTTGCGGCATTTCGCTACTTCAGCGCAGCAAGGACATTG
ACAATGTGTCCTGCATGATCAAGCCGTATTTTTAGGCAAACCTCCGCGATTTCTTATGACACGAAGTGCATTTATTTCGACTGGGGCTGAATTGGCGTCC
TAAACTGTACAATAAGATAAATAGGAGCACGCAACGCAGCTCACACGTCCGCGACGAACACGTCTTCATCCACAACGAAGGCCGACGCGTCGAAGCTCGG
AGCCGGCTGGTCAGATGACGTCGGTGTGAGCCAGTAGTCACTGAAGTCCAGGTTGTCCCAAGTTCTCCCACGTCCACGGGGGATGTCTTGCCCTCTGGCA
ACGCGGCCAGCGCCTCAAGTCCCGTGACATCGAGGCATTTACTAGCGTCTCCCTGTCCGTCCTGAAGGATGCGATCCAGCACCTCCTCGTCCACAGCATC
AGGCAGTCGCTGCAGCTCCAACAGCTGTGCGTCCTTGGCCTGGAATCCGTCGAAATGGCCGCCGTCCAGCAGACCTAGATCCTGCAAGAACCAGCCGGTG
GGCCCTGAGCTTGCACTGGAGGCCTGCTCGGCCTGCTGCCTGGCACGTGCCTCCTCCTTCATGGCCAAGTGGGCGCTGAGCGGGGCGCGTCGCGCGCGCT
GACGCGTCTTCTTGCGCAGACGCTTGCCGGCAGGCTCATGGTCCGCGGAGGCCTGCGCTCTGGTCTTGCGCTTGAGCTCGAGGCGGCGCTGGTTCTTGTT
GGCCTTCTGCCGGTGCAGGTCGCATAGGTTGTGGCGCTCGCCGTTGCGCTTGAGCGCGCGCGGGTTCCAGCACTTCTTGCTCGGGTAGCGGCACATGACC
TCGGCGTCGTGCGCGGGCGAAGGCGAGGGCGAGGGCGTTGGGGGCTTAGGAGAGGGAGAAGCTGCGCCGGGGCGGGTGGCCATCATTTCTGGAGAGCAAA
AGGACGAATGATCTCTCGCTGGCCACGCACCTGAGGCTGCTGGAAGATCCCAACTGCTCCAAATCGGATATGATGGCTACGCGAGCCATTTGGGTGAACC
AGATGTCGGTGCAGAGACTCAACCCATAGTGAGCGTCAATGCGCGTGGATTTTTGCCGAAAATCCGCGGACAATTCAAGTGAAGTGACATCGGTGCCACC
TTCCTGCACGCCCGGTGCGCCATTGACTGCCGCGGCAGCTCCGAGCGGTCGAATACGTTTTCTGCCCTGCTGACTGCAGCGGGAAGTGGATTCAGCAGGT
TGCTTTGCAGGTTATCAGGCCATGCGTATTTGTGCCAGTTGGGACAGTGCCGGCGGTGCGGTGATCAACTTCGCCTGCGCCGTCGGGTAATCCCTCGACT
CGGAATCCACGGCGGAATTGTCGCTGCAGTTTGCGGTTTGCGTAGATCAACAACAATCAGAAACTCTGGACTCTTGTTCAGAAACCGAGAGATTTTCGCC
CTGCAGTTCTCTTGTGTTTTCGCTGCTCGTATCTTCGTTCTCTTCCACGTGGAGAAGGTGTTTGTGTCCATTCACTTTAGGTTTGCTGTAACTTTAGGAA
ATTCTTACTTGTGGCACTGCATTCTGGCGGCTTAAATGTTGGCACGGGTGACGAGTGACGGTGCTCGCCGGACGTCCGGCTGCCACGAGCTCTGCAGCGT
CGCGGAGCTCATGAGCCCTTCTCCCGATCGAGCCACAGCAGTGGCAATAGGTGGCAGCAGCAGAGTCGGAGCTGCAGCAGCGGTCGATTCCGTCGTCGTC
GGGCTGTGCTGCATCCACCCTCGCGCCTCCAAAGACGGCTCCATTTTGGCCAGAGCGGCGACTCGAAGCATAGCACGAGGGCTCCTCGGGTAGGACTCGT
CCATCCATGTAGAACTCGATTCACGCCATGTGTCCATTTCGTTGCTGTATGACGGGAGCGTATTACCCATGGCCACGAGTCCTGCTGCTCGCTGCAGGTC
TACAAGTGACGGGGTGGCTCGTCGAATGTACTGCGTTGTAAGAGGCACCGCGCCCAGTTCCTGCTCCAGTTTCATGGTGATCGAGGCACGCATGCGCATG
CGACGCTCCAGGTCGAAGCCGCTTTGCAGCGGCAGGTGGTTGGGCAACCCGAGCACGGCCTGGCCGGCCTTGCGCTTCTTGTCGAGGCGGCGCTGGTTGC
TGTTGGCCTTTTGCCGGTGCATCTCACACAGGTTGTGGCGCTCGCCGTTGCGCTTGATGGCGCGCAGGTTCCAGCAGCGTTTGCTGGCGTAGCGGCACTT
GAGCGAGCTGAACTCGTCGTCGGTGGTCTGCATGGACATGGCAATTTTTCGACTGCGGTGGGAGACGGATGTGTCAAGGCGTGGCAAATTCAAGAGTGGT
TGGTACCAGCGTCTTCAAGGTGCGAAAAACTCAGGAACGTCGACTTTGTGAGAGCGCCGGCATTTTTCGGAGCTTTTCAAAGACGTAACTGCAAAGGAGC
TGATTTGCGTTCGGAGCGAGCAGCCTCCGCGGCTCCGGACGCACCGAGCGATCTCGCTTCACAAGCAGTCGCTGTCAAATCGTCCCATGGGGGGCATCTG
CGTTTGCAGCGATCGCGGCGATCAACAACTCGGTCTCCGATCAGCATGAGATACCTTTGCCACGGTTCCTGCGCGGCCTGATTTCCCGAATCAGTTTCGG
CGGCTCAAGCAATTGGTACTGCACTTGCGAGCAACCGAGCAACGTTAGCGGGCCGTGCCAGCAAGAGCGAGACGCCCCGGAACTCGACTCCCGCCAGGAA
ACGCTGCGCCGCTGGCGAACGGGCGTTTGCTGAATAAGCCCCATCTGATGTCGTCGGCTGAAGTTGCAGCTCGAGCAAGCTGGCAGGAGAAAACTATCTC
GGTGCCTGACCGAATCTGACTCAAATCAGTGGGTTGCCACGAACATCGCGTGAGGCATCTTCCCCGTGCTCTGTGTGCCACGCAACACTCTCGGTGTCTA
TACTGGCGCCAGCATTGTCTTTCCTCTCTAGTCGGGACTACCGCACGGTACACGCTGACTCACACTTGCGCCGCACGTTGCGGTACACTTGCGAACCTTG
AAGTGTTGACCATCTTGTCGACCTGCTACAGCAGGAAGGCGAATTGAGCCGGAAATGCCAACGCGTCAACAACGAGAACGCGAATAGAGGCCAGATAATC
GCTTGTCGTGTTGACTTAGCGCACGCTCGGGCTGGCGAGCATGTAGCGTTCGACTACATTGCACTGTGGTCGGAGTTGCAAGAGGAAGCCGGCGGCAATG
CATTGGATGTGATGTCTCCTCG