Description :
From Genome Similarity Track
Location :
Scaffold_134:21614- 24536
Sequence
2922 bases(100 bases per row)
ACAACATGGTTGGTTGTACTATGTATATTGCACTCGACTTCATCGATGAATATTCTTAATTGCTCATGCGAGCGAGTGATATTATGCTGACAGCCGTCAG
CACTTCAACTGTTATGCTCTAAGAATGGCTGGTGATGCCTCGAGAGCTGTCGAATGAGCCGACTACGTTTTATTACTCATAAACCACTTTTTACACCCCC
ATCGGGATTATGCACAGACGTGATTTGATTATATTTTTGTCCATGGTCGTGCCGAACAAGGTTGGTCGGATGTTGACAATCACATTGGTCATCTTCGAGC
CGTGCTCGAGTGCATGCGCACTAATAAATTTTACGCCAACGCGTCTAAATGCATTTTTGATGCAGAGGAGATTCCTTTTCTGGGATGTTTCATTAGTAAG
CGCGGCCTTAGAGCGGACACCGCTAAAGTCAAAGCTATAGTGGACTGGTCGATTCCTAAGAATCAAAAAGACTTGCGTATGTGGCTTGGCCTTGCCAATT
ACTTACACAAACACAGTGAAATTACGCTGATTTGGCTCGGCCATTAACTGATCTCCTTAAGAAGGACACAGATTGGCGCTGGGACAACACCCATGCTGAC
GAATTTCGGGCAATAAGGGAAAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGATGCTTCCGATTTTG
CTACAGGCATTGCCCTGTTACAAACAGATTTTGCAGGCCGCGAGCGAGTTATCGCATTCGAATCCCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGT
TCATTACAAAGAACTACTTGTTATGAAGTATGCGCTCGTCCAATTTAGATTCCATCTGCTTGGCTCCAAGCCATTCGTCGTCTACGGATCATGTGACATT
ACGCACGGCGACACAGTCGCCTCACCTCGCTCAGAGAATGGCTCGGTGTCTTTCTTTCTTTGCGGAATGTAACTTCGAGGTGAAGTATTAGCCAGGCAAA
CAAAATGTATTGGCAGATGCCCTATCTCGCAGACCTGATTATGAGCTTGCTCATGTCACGACTTTGTCGTCGCCTATTGAGGAGTTAATTCGTGTGTCAT
ATCCACGGGATCTTCAGTGTGTGGCATTATTTCATGCCCTTGGAAGTGAGGAATACAAGGAATTGGACAGTCAATTATCGGCACTCTTTCGGACCAGCCT
ACATGGATATTCCATCGATAATGGCTTTTTGTGCTATCGCACAGATGTAGCGAATATCGCTCGCATCGTTGTGCCTCAAAATGAGGGTTTAAAGTGTCGA
ATCCTCTATACTGCCCTCAGTGGGCATTTGGGCCGGAAAAAGACTTATGGCTATGTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGATTG
CATACGTGCTTACATGTGAAACGGTCGAGCGGGTCAAACCCTCAGCACATTCGACTGCGCCACTCCCAGTTTACCTGAGGCCACGGGATGTTGGGAGTCC
ATCAATATGGATTTTTTGTTTGGTACACCCGAAGACTATGACGGCAATACGGGAATTGTGGTCTTGATGAACGTTTAAGCAAGATGGATCACTTGGCGGC
AGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATCCTGTTTATCGATCGTGTGTTCGTCAACACGGGTTGCCGCTAGCAATCATCTCTGATCGCGAAC
CTCGCTTCACCAGCAAATTTTGGACTTCCATCTTCAAGGTGCTTGGCACGCGATTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAGACTGA
GCGAGTTAATCGCGTCATTGGCGACGTTCTTCGGAGTGTTTGTGCTGAGTCGACTAAGAATTGGAGCTCGATGCTCCCTGTCATTTAGCTTGCGTTGAAC
GACGCTGTTCATGCCTCGACGGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTG
GTGGGGGAGTCTGCTGGCAAGCTTGCTGAAATCAGCCCTACCACGATGCAGACACAAGTGAGCGAGTTTCTCGCGACGCGCTTTAGTGCCTTACGGCATG
TGCGTAATGCAATGGCTGATTGCCAATACAAACAAAAAGAACAAGCCGATTCTAAAGGCAGAGGATGTATTGATTTTTATGAAGCTGGAGACCAGGTCTT
ATTAAACGCTAAAATCCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGGTCATAGCGAAGAAA
GGCCTTGACTATACACTCAATCTCCCGCACAAGTTGCGCACACACCCAGTGTTTTACATTGGCTTTCTTAAGCCATATCATGATCCTTACCTCGTGGACT
GGAAGGCGCTTGCGCCTGAAGAGGGACGTCGTCCCCGATAACTGCATCTTCGTCAAGAGCTCCACCTGGCCATCCAGCCGTGGCATGTTGTACTCCACAT
TACGCAGTCGCTTGTCGACCGAGTCGATCGAACCGAGACGTTTCATCTGCTCACGCAACTGGGCCAACTCAGTCGATGACTATTCACGAGCGCGTTGCAC
TTGGTCAAGGATCTCCCAGAGTTGTTTCTTCTTAATCACATACTGATCCAGTTCCGTCTGCACGCGAGCGAAAGAATCTCGGAGTCGCTTCACCTCTGGC
ACCAAGTTTTCATGAGCCTGTGCCGACACAGCGACCCCCCCCCCTGCGTTGCTCGACGAGCAAGGGAACTTACAGTTCCATGTGGAGAGACTTCTGAAGC
GGCGTTGTCGTAAACGTCAATACCAGTATCTGGTGAAGTGGCGTGGATACCCTGAGTCTGAAAATTCATGGGAGTTTGAGGTACCCCTTCGGCAAGATTG
CCCGTATGCCGTTGACGTTTTT