Description :
From Genome Similarity Track
Location :
Scaffold_46:216109- 224639
Transcript NameFunction/comments
Hyaar_Emoy2806128double stranded RNA binding, putative
Hyaar_Emoy2806129hypothetical protein
Hyaar_Emoy2806130Monovalent Cation:Proton Antiporter-1 (CPA1) Family
Hyaar_Emoy2806131Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
8530 bases(100 bases per row)
CGGTCGGCGAAACACGATATTTATTGTACAGCGTTGGCACTTGACAGCCTCATGCTGTTACGAGTTCCAGTTTCGCTATGGAGTGCGATGACAATTTATT
GAGAAGGCACGATGAGAAATGTGGACCCGAGACAGGCACAAACCAGCATCGGCACGGACGCTGGAGCTAGACAGTGTTGCTGAAATCCTGCACTTTTCAT
AACGTCCAGCCAAGAATGAGGCAGTGAAGTCTTCTAGCCGTCCAACGACTGACCAGCGCAACGTAAACTCGATGAGTTCAGCCCAGCGAGATAGACGTAC
GCTCTATTGGCCCGACTGAGCACAGGAAAAATGCTGTCGTCGCTCGCAGAATTTTGTGCAACTTGTCCGTCTTCACGAGGCATAAATGATTCCAGGCACG
GGCTTGCGGCTGTAGAGAACTACATTCCGCGACCAATTGGTCTTGCCGAGTTGAGCTTTGTAGCGGAACCGGCCAGCCAGCAGGAACGCATCAATCTTCT
CTACGACGTCCGCACGAACCTTGATCTCATTGAAACACTGGGGCACCTCGACGTGCCTGCGGTTCAGCCGCTTCCGCGCATTACTGTTATCAACGATCGA
GTCAGCGAAATCGTCACATCATAACAAAGCCTGGCAGTATTTTACGTACCGATAGCATTTCCACGTCTGAGGTTCGATGATCAGATGTTCGGTCATAACA
CTTACTGTCTCCAGAAACTTCCATAGGCCGTCGTCTCCGTTGTTCAGATGAATCCACATCGTCACGCTAAAGCAAGTGACGAAATCGAATTTGCGTTTCG
CTGCCGCGCGCTCCGCCAGCTCTAGAAACGGAGCAATCTCCTTGCTAAACTTGCTCGTCATGACATCCACACGGCGGAATTGCACAACATCTCCTTCATC
CAACTGCACGGGCTTATTGGCGGCACGTTCAATCAGTGCCTCGTCCAGATCCACACCCAGTACCATGAGCTTCTTTCTCATCACTGGCTCTTCTTCTGCC
ACTGGAAGCTGTCCGAGAACACCATTCGTATTAGAAGACTCCTCCTCTCTCTCCCTCTGAACCTGGTTCTTGTCATCCAGCGATCTCAAAGCCATTTCAG
CCGCCTTAGCCTTTGCTACCTTCTTCGATACACCTTCACCATGACCCATGACCTTGTTGTTAATCTGCAGCCCACAGACATAGCGTCTGCGGTGGTTGGT
CTTGCCATGGTCTTCGATCACGTACTCCACCTGCCACTTGTTCTTCTGTACCCGCTCATTCAGAGTACAAATGTTAGCAAGATCAAAGCTGACCACATCG
TCGACTGGAACGGCAGGTGCAAGTGTTTCTTGACCAGTAAGCGCATTGTAAAGACCGATAGTCAAGTCGCCTTCGTTACAGCCAATGTCAATAATAGTGA
ACGTCTCGTCTGCCGCGTCTTCAGTCGATTCTTTTACAAGTAGTGCCCGTTTAAGCGCGTTAGTCGTTTGCACGTCCATAAACCGCAAGCGCTCGTGCAC
CGGGTTGAAGCTGTAGTATGCGTGGAAGTTCCCGAAGATGTGTCCATCAGCCTCGAAATTCATGGTCGTGGCGGATACAACAAGTACCGTGATTGGCCGA
ATAGTATCGTAAACCAAAATGTTAATTGAGAAGTTAATAACACAAACAATGTCGGTTAAATCCAACCGGTCGTCGCCAACTGTCGGAGTTCTTAACTTTT
GTGCCAAGATAACGGTTTCTCAAAAACTTCAAAATGCTCGGACGTCGCTTGCTTCGAGTCGTGCCCCGACTATCGACGAGTCGCTTCGTCGCGTCAGTGT
CTGAAACAGCGAAAAAGAAGACGAGTGGAAATGAGAGCAGCTTCTCCCGATACGCTGGCATGGCAGCTTTTGGCGCAGTGGTGCGTTTAGCAATACATAT
ACAATAGAAGACGAATGGTGAGGGTTGTGATGGTAACCAGTCTACTTTTTGTGGCTGCAATAGACGGCAGCGACGGCATATCTGGGCACATGGCAGGTAA
AGTAGACAGATATGATGATGCAAAGGGTTCCTTCACGTTGATCTAATCGTGAACGTTCTGTGATTCCTGGTTGAACACGACAGGTCGAACGCTATTACTG
GAAAGTGGATCTGATCAAAGAGCGTACCAAGGAGCTGTCGGAATCGGTCATTGAGCTGCCGAAGAACGCGACAGCGAGCGATGACACGTCAGTTTGATCG
TGATGCTGAGGCTTGTTGTATGAATGCACTCACGACTTACTATCTGCATTGATACCGGATGCAGAGATGACATCGAGTACCGCCAGCTTCGTGTGGACGG
CCGTTTCAAGCCTGGCAGCACGTTTTACTTGTGTAACGTAGATGACTTGGGTAGATGGTAGCTATTGATGCAATAGCTGTTGGGTACCTGACATTATGGG
TGCGTTCATATTACAGATCCCCGGTCTGCCCCTGCCGACCCAAACGATTCGGTGGCAAGAGTGAAGTCTGGTGGCTACATTTACTCGCTGCTGGAGCGAG
AGAATGGGTGTGACTTTGTTTGGTGGCTATCGTTATTGTGCAAACCATTTACATGAATCCTGCTGTGTTGTGTAGAACGCCAGTGATCGTGAACCGAGGC
TGGCTGCCTCGCGAGCTTCTGGATGCTCACATGGCACGCGATAAGAAGGAGGAGGACGTGAACGTCTCGTTCGTCGGCGTGCTTCGTCACGAAGAAGTCG
TACGTGCATCCAGCGACATCAATTAATGATTGTGTGGACCGTTTTAACGATGCATGCACTACAGAGGAACCATTTCACGCCAGACAACGATCCAGAAAAC
CGCCACTTCTTCTACGTGGACCAGAGAGAACTTGCTGATGCCATGGGCGTCACATCGACCGACTTGCCCGTCATGGTCGATGCGCTAGGTAAGTGCTGGA
TAAATGTGTGACATCCTGCTGGTCTAATAATTGCATTCTACTTCCTTCATAGCGGTTGAGGGCGCAAGTGCTGAGGTGACGCTTGACAAGCCCATGCAAA
AGAGCCTTGCGTCGTATTTGGAGTTCTACATGACGCCAGAGAAGCATGTTGGATACGCTGCAACGTGGTAGGGGACAGTCCTCTGCAGTCTGTATTAAAG
AGTCAAGATATTAACTGACGAATGTGTACAGGTTTGGCACCAGCCTTGCAGCCGCAATCATGGGCATGCTGCGCTTTAAAAAAGGAGCCGCACGAGCTCC
TCGTGCCAAATTTGACTACCGCTAAAAATAGCTGTCGCTCGCGCAAGGTTAAATCTCACCCAGTCCAATTTAGCGCTATTTTCTGAATTTTGTCGATTAT
TAAGACTGTCTATGATTCGTGAAAATGCCGCACGAGCGAGATGTCGAGGCGGCGGTCATGGCAGACGCGGTGCTGCTGTTACTGATGCTCTTCGTCGTAG
TCCTGGTGTCGTTCGTTCTGGACCGGTACTCGTGCAATCTCGTGTCACAGAGCGGCTTCGCTATGGTGTTTGGCCTTGTCGTGGGGCTCGTTATGATCTT
GGGGGACAGACATGCAGCGTTGCATTCGCACTTAAATCTGGACAGCAGCCTCTTTTTTAGTGTTTTACTGCCGCCGATTATCTACGAAGGAGGGTTTTCG
ATTAAGCGGCAAGCGTTTTTCCGGAACTTCCCGGCCATTATGGGCACGGCCGTCATTGGTACACTTGTTGCTGCGACCATCACGGGCGGCATCTTGTTTC
TCGCTGGAAAGTTACAAATGGTGATAAGACTTTCGTGGGTTGAGGCTTTGCTGTTCGGAACGTTGATCAACGCCTTGGACCCTGTGGCGACGTTGTCGTG
CTTCAATCGACTTCGCGTCCCGCCGCTGCTGTTCAACCTCGTGTTTGGAGAGAGTGTGATCAATAATGCAGTGGTCATTGCTTTGTATCAGACGCTGCAC
AAGTGGGACGTTGGCACTGACTTGAGCTGGAAGCAGTTGCTGCGCGTGGCTCTCAACACGAGTGGAATGTTTGTGGGGTCACTGCTGGTGAGTGCGGCGA
TCACACTGAGTGGCGCCTTCTTGCTCAAGCGCACGGTCTTTTCGACACTGCACTTCTTCCCGAGTTACGAGATCAGCTTGTGCTTGATCTTTAGTCTACT
GACGTATTACGTAGCTGACAGTCTGGACTTGAGCGGCATTGTCGCGCTGTTCTTCTCGGGAACCATGACAGCTCACTATCACTTCAACGCGCTGTCACGT
GAAGCTCGGCATGCATTCACCCACTTACTGCACACACTGTCGTTCGTGTGTGAAAACGTCGTGTACGTGTTCATGGGCACGTCAGTGATCCTGATCTTCT
CGGGCCACCAAAAGCACAGTTCAAGCACGGCGCTTAGTGTGGACGATGTTGACTGGCATTTCATCGCTCTTACACTTGTAGCCTGCGTCGTAGCGCGCTT
TTTCAACATCTTTCCGCTCTTGAGTCTGTCCAACTGCTCGCGGGATTCTTCGGACCGTATCCCGATCAAACACGTGAGCGTGATGTGGTTCGTCGCTCTG
CGTGGATCCATTGCGTTTGCACTCGCGAAGAACTGGAAATACGTTGGTCTGCACGGCTCTCACCGTCGTCTTGTGGAATCGACCACTCTCGTTGTCGTCC
TCTTCACGACAATCGTGATTGGCGGCGTGACAGGGCCAATCCTCTCCAAGCTGCGCCTCACCGATCATCACAGCGTGCTGAGGCAATCGGAGCCTGGACC
AAATGCTGGACACGACTCGAGTTGGGTCGAAGACCAGTCACAAGCGCTACAGCGCAGCACGCGCCACTTCGCGCTTCGCCGGAACTCCAGAAACACCGAT
CTGCACGACTCGCAGCCGTCCGCAGAGAACACGACAGGAGAGCAAGCAGCTGGTATGGATCAATACCCAGTACTCACGTCACGACCGCAGTTTCGAGATG
AGGATTACAGCGATAATGAGGGAGGAGAGCGCAACGGTGACCCATTGACTCAGCGCAGCGAGACGCTCGCTGGCGCATTCATTCGCAAGTGGCAAGCTTT
TGATGTAGCGTACATGCAGCCGATATTCGGTGGCCTCGAGACCGCTGCGATCCGGAGAGCAGTGGACGAGACAGACGTAATCGGTACTCTTGTCCAGGAA
GATGACGAGCTTCAAGTAGTCTGATCGGTCGCCGAGAACGGTGTACGCTACATATTCTGAAGATTACCATTATACCGATCTGATTGGCTGATCCGACATG
TTTTTGTGTACGTCAAGTGTACATACGGAGCTGGGCTGACGTCCCTTTTTTGCGGACCTAAATGGATAGGGTTTCGGATCTCCCACCGACTCTTACCGGT
AACTCGTAGCTGATGAAATCATGCTCAAGGCCCACGCTCATAGAATACTCACCAATCAGAAGCAGCCAGAGTGTTAAAAGCGATGGAAGACGCCGTGCTG
TTGCTGCTGATGCTGTTCGTGCTGGTGATGGCGTCGTACATGCTCGGACAGTACTCGTGCATGTTGGTGTCACAGAGCAGTTTTGCGCTCATGTTTGGGC
TCTTCGTGGGACTCTTCATGATCGTGGGCGGCAAGCACGCGGCGCTGCACACGCACTTGAACCTGGACAACAGCCTCTTTTTTAATGTATTGCTGCCACC
GATCATCTATGAAGGAGGCTTCTCGATCAAGCGACAGGCTTTCTTCCGCAACTTCCCGGCAATCATGAGTACGGCTGTGCTGGGCACCGTCGTTGCTACG
ACCGGCACGGGCGGCATCTTGTATCTCGCAGGCTTAGCTGGTCTAGTCACTAAGCTGTCGTGGGTCGAAGCCTTTCTCTTTGGTACGCTTATCAGTGCGG
TTGATACAGTAGCGACGCTCAGCTGCTTCGACAAGCTCAATGTACCGCCGCTACTGTTCAACCTCGTCTTTGGCGAGAGCGTGATGAACGATGCCGTAGC
AATTGCGTTGTACCAGACGCTAAACAAGTGGGATGCAGAAAGCAACTTTACTGCTAAGCAACTGCTGCGAGTGGTACTTAACACTGGCGGTATGTTCACC
GGGTCGTTGCTCGTGAGTGCTTTGATCACGCTTAGTGGAGCTTTTCTGCTCAACCGTCGGTTTTTCGCGACATTGCGCTACTATCCGAGTTACGAGATCT
CGCTGTGCTTGATCTTTAGTCTGCTCACGTACTTTGTGGCGGATAGTCTAAAGCTGAGCGGCATTGTGGCGCTCTTCTTTTCGGGAACCATGACGGCGCA
CTACCATTTCAATACGCTATCGAAGGAGGCGCAGCATGCGTTCACACACTTGTTGCACACGTTGGCGTTTGTGTGCGAAAACATTGTGTACGTGTTCATG
GGCACGTCGGTGGTCATAATCTTTGCTGGTCACAGTGAAGAAAATGCCGGTGCTGCCCTACGCGTGGACGATATCGACTGGTCTTTCATCGGTCTTACAC
TAGTGGCCTGCATCGTTGCACGTTTCTTCAACGTGTTCCCGTTACTGAGTATGTGCAACTGCATGCGTTCTCAGTCAAATCGAATTCCAGTAAAGTACAT
GAGCGTCATCTGGCTCGCTGGTCTTCGAGGATCGATGGCTTTTGCCTTGGCCAAGAACTGGACGTACGTTGGTCCACACGGAGCATCACATCGCCGACTG
ATTGAGTCGACGACTCTTGTGGTGATTCTTATCACGACGATCTTTATTGGCGGTCTTATGGGCCCGCTGCTGTCGACCTTCCACCTCACTGGCAAGGCCG
ACGACCAGCTCGGTCAATCGGACACAGACAGGGGCTCAACAACTGCATCAGAATCCGAAGAGACTATATCGCGGCTAGTCCAACGAAGTACACGTCACTA
CGACGGCGAGCTGCATGGCGTTTTAGCGTTTCCAGAAGAAGAACTCACCACGACGAACCGCGACGAGAGTGGAAATGTGATTCCGATCCTCACTTCACGG
CCACAATTCCACGATGCCATGAGTGACGATATGGAGGACTCTGAGGTGGCTACATCCACGCATCGCACTGTTGATCGACCTCTGGGCGATTCGCTGACCG
GTGCGTTCTTCCGCAACTGGCAGGCATTCGATGCTTCATACATGCAGCCGGTGTTTGGAGGATCATTGCAGCGACCCACTGCAGCAACAGCTGATGTCGA
TTTGGTCAATATGGGCCTGGACAAGGTACCGGTAGCGAGTGCCGTGTAAATAAATTGTAAGTCTAAGATCCGTCAAGTGTAGCCATTTTTCTCAAAGTGA
ATAGACCCAACTGTATCATGTTTCAGGGTACTGCCGTGCGGATGCAATTGGAAAGCTATGACGCCGCCGGCGAACGGCGAGAGCGTCAACGCAGCCGCTT
CTGCAGCAACGCAAACAGCACTTAGCATCGAAGAAGCTACACGAGCTTCTTTACAGTCGAACGAAGGTATGAAGGTGTCTGCTACCACTGGAATCGCTGC
TGCTGCTGCGAGCGGCAACGAGGAAGAAGACAAAATGGTCGAAGCACTGGAGAATTTGATTCTGGAAGCTTACAACAAGATGCAGATCGACGGAGAGTGC
ATCTTTTTGCCAGAAGAAGTTGCAGAGAAGCTACACCAAGCTGCCGAGCAGGTTTTGTGACGTGTTGGTGACGGTGTTTTGGATGCAGTGGCTTGACTTC
GTGGTTTTGTGTGACGTTAGGTGCGCATGCCAAACGACGGCGGGAAGCAGGAGATGGAGGAAAGTGCAAGTGATGGAAAAGATAGCGACAGTGTTGATGT
CTCTGCAAGTACGGATGAAGTGGAGGATGCAGTGGTAACTCTGCTGCAACAATCGTCGGACAGACTCGAACCTGAGCACGAAAAGGAGCAAGAACAGGAC
AAGAAACAGGTGGAGGCGATCGAGACAACTACTGGGGAGAAGAAGCTCGTGCAAGAGGGAATGAGGATACACAGGATACAAGTGCTGCAGGCTGAGGTGA
TTGAGCTGTGCGAAGAAGAGCATGAGCAGCAGATTTCTCGAGCGCCCTCGACAGAGAATGTTCTTACGGATCTGACGACTATAGCTGATGCAGATGAGGT
TGTTTCGAGCGATCCACTCTCACCGTCATCGCCGCTGTACTCGCAGTCGCGTAGTGGGGTGGATATACCGAACTCGAGGGTGTACACAAAAGCTCAAAGA
CCCGGCCACTTCCCTCCCCCGCCCCTCATATCATTGAGTTCTACTCCAAGCAGTCTTGCTGCGAGCTCAGGTCACAGCGGAAGGACTACATCATCAAGAC
CAACCGATCAGCCTAGTGGTGGCAAACGAAAAGGTAAGGGGATTACTTACGAATCACGAAGAGAGGCTGCACAAAAGCTTAAGGAAGACAAAAAGAAGCG
CGAGCTGCTCGTTCGCGAGGCTGCACGGAAACAGCGTGAAGTTGCAAAGCGGCAGCTCGAGGAGTTGCAGCAGCAAAAGATGGAAGAGAAACGTGAGCGT
GCACGACATATTCGAGAAGAGAGGCTGCATCGTCGAGCCGGGAAATCGACAGGTGCTAAAGGGACAAAGGGGTCGGGATAGTCGAAAGTGTGTCGCACGG
GTGACGTCCTTGTGAATGCTACTTGTTAGA