Description :
From Genome Similarity Track
Location :
scaffold_7:216087- 217356
Transcript NameFunction/comments
Plaha_PHALS_03501hypothetical protein

Sequence
1269 bases(100 bases per row)
CGCTGGTGATAGACGAATGCAGAGAATGTATTCGACGCCGGGAAATTGCCTCCACTGATCCGCTTTCCGATCCAAATACGGCCATCCTCGTGAGACGCCC
ACTTCCACCTTTAATGTGTGATATTCGATCCACGTCATACCACCAGGACGAATGGCACCAATACCAGGAGCAGGACCAAAACTGCAATCGGGCTCGAGCT
TTCGAAGTCTCTCAACGTAGCTCGATCCACGCGACACCAAATGATGATCACGGGTACCAGTCGCAAACACCATTTCCACCTTGAACAATTCACAAAAGCC
ATCATGGACGCCAGATGGGAGTTCGACGATGTAGATTCTACCACCTTCAAATGCCATCGCTCTGGACACCAGTGCTTGATTCTCCGTTTTGACATATCTC
TCCCAGTCTTCCAACGAGGCTTCGCACACTTCAAATCCAGGATCCGCGTCATCGCGCTCATCAGAAAGCAAAGTAGCTTCGACTTCCNNNNNNNNNNttg
cgagaggtggggtgaCTGAGTtacagtgcgtagtgacgctggatctgtatagatcacaaacggcttggagccgagcaggtggaccctgaccTTGACAATT
GCATACTTCACCGCAAGTAgccccttgtcatgaactagtaagttcttctctgcagcattgagctgtcgagattcgaacgcgatcacccgatctcgcccct
cggcgtctgcttgcaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN