Description :
From Genome Similarity Track
Location :
Scaffold_149:21606- 25957
Transcript NameFunction/comments
Physo_143713hypothetical protein
Physo_143714hypothetical protein

Sequence
4351 bases(100 bases per row)
CACTCGGAATCCACGAGGAAGTTTGACGGCTTGATGTCACGATGAACAAATGGAGGCGAGAAGCTGTGGAGATAAGCCACGGCACGAGCAGCGTCGAGCA
TGTAGCCCACGCTAATGAGGAGCTGTTGTCGAGCAGACCGAGGGTTTTGTCGCCGAGCCTGATCCTGAAGAGCGTCGGCCAGACTACCTTGGCACAGTTG
AAACACTAGGCAGATCGTCGGTGGCGCGACGCACATTCCGTGGAATTTGACGATGTTTGGGTGGTTCAAGACGCTGCACATGGCTGCTTCGTGTGAGAAT
GCAGCCACGACATCCTCCGAGCAGCTTGTAGGCGCGTACGCCTTGACGGCCACGTGAGTTTTGGTCTTGAGGGTTCCTTGGAAAACGGTTGACGTGGACC
CGACTCCGAGCTGCCGGACGAGCTCCAAATACGCGAAGTCGATCACACACTTCCGGTTCATTTCAATGAGAACGTGAAGACCTTCGGATGACACGCGCTC
GCTCAAGCCATTCTCGCGCTGGAACAGATCTTTTAAAGCACAAGCTCGCTGTCCGATGCCCCTCCAGTACTCCGTGTCAGCCTTGAGCACGCGCCAAACT
ATCAGTGGGCAAAACGCGATCCAAGTTAGCATCACGTAGACTACGGTTTGGCTTGGCGTGCCAGCAGTCTTTGGGTTCATTACGAGAACCACGAGCAGCA
CAGTTAGCATGAAGAACACGATGGCGGAGAAGCACAACTCGCGGATGATGCGCTTCGTAGCTCGGCTCGGAGGGTTAATGAACGCGTAGACGAAAGGTAG
CATCAGCAGCCCGCGTACTAAGTGAAGTCCAATGGTCAAGCGCTTCTGCTGCTCAAGCTTCCCCAACTTTGTCATCGCCCAGACGTACGGAACCGTGTAG
TACGAAAGCACCATCGATATCGCCACCGATCGCTTGACAGCGGGGAACGAGAGACTTTTCTGGAACATCAACACCAGCACGATCACGAACATGAACTGGT
TCCCGGAGTAGAAAGACTCGAGTATGATGGGAGACACGAACTCGTCGAAGTAGCCCGTTGCCAGAGTTACCAGCAGGAAGACGATGTACCCGCCATTGAT
AAGGCTCATCACAAAGAGTACAGGTTCGTACGCTGGTAAGATGACCTTCCTAGCAGCCGTTGCGTCGCCTTTCAGTGCTCCTGCTCGGTTCACTCGAAGA
TGCCAAATCAACCCCACGCAGAGCAGCCAAATGGTAACGAAGCCCGCGAGGATGAACACCAAAGTCACACGCATGCGTTGGGCCCCTTTCTCGAGGGATT
CGTGACCACCGGATGCAGACGCTGCCGACTCAACCAGAAGACGCCCGGCAGCGTTCATCCTGCAAGTAAAATTGACGAGGGTCCGTTGGGTGTGAGCGTG
GTGTGGCGACTTGGGGAATGCAAACAGGCCGACGGGGTGCGCGGTGCGAGATTGCAAGCGTTTCGCCCAGTGCCAGCGGCTCCAACGACATCGATGAGTG
TTTTCGTACAACATGGAGCCGCAGCCCCAACAGCAATTACTGGAGTTGGTTTGGGTGGGCCGCAACTCGTTGCTGCTGGCTGGCTTTCTCGAAACCGCTT
TGAGTGCATTCGCCACTAGAGGACAGGCGAATAGGACTGGAAGGAGTCAGCAAGTATGAAGCGAACGCGGGCATATCTTCCTCCGCTGGCCGGAACAAAG
ATTAGGAGAGTCTTGTTACCACTTCACGGGGCCGTCCTGACCTGTCAACGTCGAGCTCCGAAAACCTCTTCACCGAGGGTCAAACACAACGCTCAGTGAA
GCGTTGATACATATGTGAAACAAGCTTCAACCACACCTACAGCATGCTCAGCGTGGTCGAGAAGAGTTCGGTCGGCTGAACGTTTGAACTCGTCAGAGAT
GACCCGTCCTCGGAAGAAAATGTACACACCGTCACTGCCATCGGGAGCTCAGGAACCTCACGGGAGTGCGGAAGTCTGCGAAGTTATCGGTCACCAGCTC
CAGTCAGTGGTGCTGGCCTTCAGGAGCAGCAAAACGTGGTGAATCGCTCACCTATCACGTATTTCAAGGATAGTAAGGGTTCCAAGTATAGCTGCTATTC
CCGAATGCCACCAAAACCTTCGCGACAGCTGTCAAGGTATCGGATAGAGGAATCCGATATCCGGCCAGCAAGTCGTTGCCAACGACTTGTTGCCGGCATT
CCATCTCAAGCCCACTGGAGTCTTCGTCGCCAGGTTTCCATCGAACTTTGATAACGTGGTCTTCGCTATTACCAAGGTTTTGGCGAAAAAAGCGACCATA
CTCAAGATCAACTCAAGATCCCTCATTCAGTCAAAACAAATTTCGTAAAGCAAACGAAATTATTGGCTGCTTCTGCGGGTGAGGAAAAAGAAGAAAAAGA
AAGAAGAAAGAAAAAAAATAAGAGGAGGAGGAGGAGGAGGAGACATCTAAAGCGAAAGGCAAACGAAAGCTCTCAGCTGCTTTTGCGGACGAGGAAGAAG
AAGAGGAGGAGGAAGAGATGGCTCCTAAAGCGAAGGGCAAGCGAAAGCGCTTAGCTGCTCTTACGGACGAGGAAGATGAAGCGGAGGAGGAACATGGTGA
GGTCGCAGCGGTGTTGGAGGAGGGCGACGATGAGAGTGAGGAGACGGAGGAGAAAAAAAAAGAGGATGAGGGGGGCACAGGTCCTGCAGTGGTCGCCCCT
AGAACCATCGCCAAAGTGAACGGCAGATGCAAGATGCCGAGTGATCTACCGCTTGCGCTTCAGTACCAGGGCGGTGAGTTCTTTTTCGTGCGCGAGTGCT
ACGAAGCGTACTACACGACCGTGGAAACGCTGGTGTTGGAGGGGAAAAGATGTGTAACAGTGACGGGAACTCCAGGTAATTCAGCTTCTTGTCAGGATCT
TTACACTTTCCATGACTTGAACCATCGACTTACTGCTTCTTGCTGCAGGTATCGGCAAGTCCGTCTTCTACGCCTACTTCTTCCTTCGTTTCCGCATGGA
GCATCCAGAATGGACCATTGTCGCCTCAACCTATACAAAATCTGGAGGCGTCGAGAACGTGGCTGTTTTTGAGGCTGGCAACGAGAAACGTACAATGAAG
ATTACGGACGCAGCCCCAGAAGTTGTGACCAAGATTGCGTTGCGGTTGAGGGGCGTGGATCAGCTAGATTGGGACGCGCTGAAGGCTTATAACCGGGAGA
AGAAGGTGTTGTGGTTGTGTGATGGTCCGCCGCAGGTACGACGTCCGCAGTCCGTGGTTTTTACGAGCCCGATCGAGAGATGGATGAAAATAGTGAGAGA
TGATCTCTGTGACTACTACATGCCTCCGTGGACACTTCGAGAGCTCCAGCTAGCTGCTTCAGTGCTGAACTACGCCATTAGTGACGATGAAATGCAGGAG
CGGTTCTGGAAATTTGGTGGTGTGGCGCGGAATTGCCTCAAGCTTAAACCCGCAGACCTTCGCAAGGTTTTAATCCAGTTAACGGAACCGATCAAAAAGA
TCAGTGATCGTGGTCGGCTCGAGAACCTGCTTGAGGGAAACGAGAACGAGGACACTCGCCATCGTTTCCTGCATTACGAGCCGATTGGTGACGGGGGTGA
AAAAGAGGAGAAGCTTGTGTCAGACATGGTTTGTGAAAAACTTTCAGAGCGACTGTTGCAAGTAATCAAGCGCAGTATGAATGCAGTGAAAGGCTTGCTT
GAAGGAATACCAGCAGCTGCCTCACTCCGTGGAGGGATTTTTGAAGCCAATGCGCACGTAATGCTGCAACTCGGGCTTGATCTGGATGCGCGACTGCTCC
CATGTCGAGACACACGAGGTCAGAAGACCGATTTCACTATCACCGTGAAGGGCAGCGATGAGACCGATGTCTTCGAGACCGACGCCTTGTCTCCTATGCT
TTTAAGCATCGGACCATATCACAAGCCGAAGTCAAAGACATTCGAGTCAATCGACGGATTCTATTTTCCAAAGACGGCTTTGAAATCCGGTAAAAGCTTG
GCACCATCAATGAATACGGACGACAGGCGTATACTCCTGTTCCAGATGACCGTTTCAATGACGCACCCTGTACGAGCTTCTGGGGTAATTTACGTGCTTA
GGAAGCTTGGCCTCCTGGAACATGTCGTGAAGAACCCCAAGCGAGCTGCACTTATCTTTCTGCTGCCTCTTGTTGAAGCGAGGGCTTTCACACGACAGGA
CATTACCACGACTGACGTGTCTCCAACCTTATACAAGACATTGAGGGAATTGGGCCACAAACCGTGAAAACACTAACGGGGGTGTACAAGGTCAAAACGG
TTGCGGAGTTGAAAAAGATGGTGGGCCCCTTCAAACAAAACAAAATCAAGA