Description :
From Genome Similarity Track
Location :
Scaffold_2439:216- 2975
Sequence
2759 bases(100 bases per row)
AAATCCACCTCCCCACAATTCATAGAGGACTGCAGCGAAAAGTGGCTAATCTGCGAGGAAACGAGCGTAATAGTTTCAAGCGGCCCCAGAAGAAATTGGC
TTCGGCCCTGAGCGAACGGGGAAAATGATTAAATTCTGCCCACCGAAAAAGACACAGGCTCCTTAGAATTCGCCTCCAATCCCTCCTTGGAGACTCGATG
ATCTAAGTAATTCACCTTACGCATCCCCCCATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGATATGTCACTCTCTCG
CACAGCTGATCCCGCGATTCCGCCGGGATTAGAATGTCGTCGATATAGGATCTGCGCCCTAACACGGATGGGGTTCCTAAATCACCTGGTTTTCCTGCTT
CGAATGGATCCACTTCCGCATGACCTTCCCCGGATCCATCCCCTCCGGGTTCCGGTATTCGGGTAAATCCGTAGAGGGCATTATCGATCAGGCGTTAATA
GATCTGGGGTGCCTTCGTCAATCCAAACGGCATCCGGCTCCATTTGAACAGTCCAAAAGGTGTGATGAATGCAGATATTGCGCGAGCTCGATCCGTCATA
GTCACCACCCAAAACCCACTTGCCATATCTAGAAACCAGTACCAGAGTACTTTGTCCAAATCTTCCAATAGCTCATTGATTAGAGGCATTGGATACACCA
TCAGTCGGGTAAGGCCGTTAACTAGCCGGTAATCAATACACAGACGTATATCCACTCCGTTCTTCTTAACGATGATTACCACCGGAGATGCCCACGGGGA
CGTTGAGAAACTGATAATTTTGGCTTGCAGCAAATCAGATCCGATAGTTTTTCTCGGAACTCAGGCGCCACCTTCCGCACCCTTTGAGCGATCGGCTTCG
CGTCACCGACATCGATGTCACATTTGACTCCGTATGCAGCGGGTGGTAATGCGTTTCCTTTGCCAATTAGCAGATGTCGGCTTTCCCAGATCTTCTGACG
TAGCCGATCCACTTTCGCGGGTTCGTTCGCTCCCGAATCCACTGGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGCC
ATACCTTCCCCAAGCTCTTCGGCGTGTAGATCCCCCGCCTTCCTGGTAGCATACCTGTTCGTCTTCAGTCTTTGTCGGATCCACCACTGGGTTCAGGCAC
CTCGATTCCCCTTCTTCTGTCATTCCTTCTGTCTTCATGGGATTGGGCATTCTGGTACCGGGGAAACTACCTTTTGGATCGACTTGATCTTCTGGTGAGT
TTACACACGACGGCTCCTGCTTAGTCAGTGTTGACACCCTCGAAAGGGATCCGGGCATCCTATCCCATGGAAAGTTCGGATCCAACTGTGGGTCTGCAGG
ATCCAGCGAGCCGGCTTCAATTCTCTGCGATCCCCCATCCACCGATTCTGGGTTTTCTAGGGACTGGCTCTGGGTATCACCAGCGGTCTTGGATCGAATC
TCTACCACTTGGATCCCAATCTGACGATCTCTCTGCAGGATCTCTCGCGGAGTTGGGTATGAAGGCCGATCCACAAGGGGCCAGTTGGCCCCGCCGGGAG
CTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTATCTATAGCGACGGGATCCCACTGACACATATCCAGGTCGC
CTAGGGATATCATCCTTCGCCAACCATCCTCATAGTGGTCCAGTAATAGTCTCTTGTCGCTGACATTCGTGACCTGGAGGTATTGCGATCGACCTGGTCC
TTGGATTACCATAGGCACCCACTTCTCACCCCGAGTGACCCACAATTTCTCATGTTCCATCCATTTCAACCGACCTGGCAGTTCCCAGGTCTCTCCGGGC
TCGATCCAGGTCGTCTTATCCGCTTTATGATCTTCATCTTCGCCCCGCACAACGGTCGCCGTTTACTGAGCTGGATCCGCTTCTCGACCGGGAAACACAG
TGTCTCATCTACCAGATCCAACCTTACCCCGGCTGGTACCATGAAATTCATTCCAAGAATAGCCTCTTGACCATCGAGGTCTTCGACCCAAATATCGAGC
CAATATACTAACCAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCC
CATCCACTTGGCACCCAACCTTACAAGCAAAGGCGGTATCTAGTATAGACACCTTGGCACCCCTATCTAGGAGTAGGATTGCTTTTTATTGTTGATCTTG
CCCCCTACCTTGGCTTGTCTGAACCATTTTCCTGGGGTATGGTACTTCCAGTATCCACGGGACTCCCCTATTAGCAGATCCATGGATCCAACATCTTCAG
ATCCACGGGATCCGGTGACCTGACAAACCTTGGGTGGGTCTGCAATGATTTCACCCTTGGTAAGCTCAAACCATTGGCCATGAGGTTGTTTCTCCCAATA
ATCGCGCGCTTCTCCCCTTTGAAAATACAGGGTTGAAGGAACTTCGGTTCTGGCAAATTCGTCCACTTGGCGCAAACTAGAAACCTTGGCAACTGACACT
TTCATGTAGATCACGAGTATTATCGACTGGATCTAGGATCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAGCGC
TCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACT