Description :
From Genome Similarity Track
Location :
Scaffold_1670:216- 2180
Sequence
1964 bases(100 bases per row)
TGTAGATTCGTCTTCTCTTTCTTTCCGATGTGACCAAACTCACGTCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGACCTTCTTCATCCTC
CCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAAACTGCATCACGCCGAATCTGTTACGATTCGTACGATTCCTCAAGA
AATCATAGCGTAATGCTCCACAGCTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCC
GTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGACCTCGTCGGCCTCGAGGTCAACATTCCAGCTATCATCCGGTAGAAGGACT
TCGTCGAAGTCGACGCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGATCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAG
GAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCGTGTTTTCCAATCTTCTCGCTCACCCGGAAGGGTCCATGCCATAGATGGGCCAATTTG
CGGGCGTACCCTTCTTTCACTCGGTCCAAATAAAGCCACACCTGCAATCCCACTTGGATTTGATGCGGACGAGCATCTTCGTTGTATCCGCTCGATCCTG
TATCGCACTCCGCAGCCGTTCGTTCACCTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGAATCTCGGTTTCTCTTCTTG
GTGCTACATACCGGAATGGCCACTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGT
TCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCG
CTCGGCCGACCCGTTAGCTTGGGGATGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCT
GGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTTGGAAACGCACTCCTCGTACGATTCGGCAATGGTCTGCGCAGTACTAGACGCACTAGC
TTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATG
ATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTAGATTGTGGACCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACC
GCTGTACGCTTTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGGTGTCCGCCTTCCAAGCTAGCGTGATA
GTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGGCAATAGAAGA
GCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAACGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTT
TAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGACTGGATCCA
ATCCTTCCTCTGGACTTAGTGACGGCCATCACCTGGACTGTTCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCT
GATGCTCGGCAGTTCGCCTTCATTGCGCTCGATGAGATTGGCGAACTTGGACTTGTCGTTACAG