Description :
From Genome Similarity Track
Location :
Scaffold_4268:216- 1337
Sequence
1121 bases(100 bases per row)
GCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCTAGGATTTGGATCAGAGGGATTGGG
ATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTAACTTGGTACATGGGTGGGATCCCAAATC
CACCCTGGAAGTGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGACGATTGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGA
TCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAGGATCGGGCGAATCGACACAACGAAGACGTCCGTCCCCATCAAATCCAAGTGGGATCGCAGGTGT
GGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGT
AAAGCTGAAAACGGCAGGTACCGAATATCGCATGCTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGT
CTTTCGGTGGATGGATCCGACCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGA
AGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGA
CGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAG
GGAGGGGACCCATAGATGTGAGCTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAG
TGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTACGTGTGA
GGAGTCCTGCTTGATCTCAAG