Description :
From Genome Similarity Track
Location :
Scaffold_1534:216- 1309
Transcript NameFunction/comments
Phypl_g13639Avr4-associated TDF-like protein

Sequence
1093 bases(100 bases per row)
GGGGAGCTCGAGCCGCCGTTCGCCCCCAGGTTTATACGTACGTTGTTGGACACGACTGGCTTTGGTACCTCCTCCGAGATGGCCCAGTTCATGAAGAGCT
TAGATATGCAGGACCAGATCATGTGGGACCAGCTCTCGGAGGATGCTCGCCGTGCACTGAACGCGGCGACCTGGGCAGACGCGAATATGCCCTTTAACGA
CTGTAATTTCCAGCCCAAGCTGGGCAAGGCGTGGCGGCCCCGGGGTGCTTGGCCTTGTTCAAGATGGCGATGCGCTGACCCCACGCCAGGTAGGCGTTGC
CGTTATCCGTCACGAAGGTCAAGTTGGGTGCGCCAACGGTGTATGTGCCGACGTCGATGACATTGTCCTTGACCGCTGGCGGTGTTGGAGCCGCGGCGGA
ACGTGACGTTCTGGTTGGCGAAGTCGTCGACCCAGTTCCTGTCGTACTTCTCCACGTAGTGTGTGTACAGGAACAGcacggtgtcgtcgtccgtcgGGTG
CGACGACGCGATCGTATCGACTCACTGCGGCTCCACGAGGCTGGCGGGGGACACGGgtgcgacgacgccgtccagcgcgctcgagtcgtaCAGGCAGCTG
AAGGTTAACACCATCTAGGCACCGCCCTGGTCAAAGAAGCCGTCGCAGTCCTGCGGGAAGTCGGCCGGCTTGTACACTAGAAGCTTGCCCTCCTGCTTCC
TCTGAGGGaagtcctgcagcatctgcagcgccacgacgtcggACACCAGCGTGTCGGTCTCCGGCTGGTTGTCGATGTGCACGTCGTGGTACTTGCTGTA
GTCCACGATGATCGTGACGTTGATATCCGGGAATGCGGTCTGGAAGGCCTCGTGCAACGAAtcctgcagcgacgagaagTCTCCCGTCGTGGTACGTGAC
GAGGTTGTCGCCctcggcgatggcgtcgcaATCCAACTGGTCGATGGActtggcctcttcctcgacggcAGTCACGGAGGAGGTGAGGAGTGCGCCACAG
GCGGCTACGAGTGGCGCGAAGAGCGTCATCGTTGTTGACTTGGTGAATTTGTTGTAGGTTGGATGGCGGGGGGGTGTTGACTGGAGACTTGTG