Description :
From Genome Similarity Track
Location :
Scaffold_156:21598- 26144
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.17Phospholipid-transporting ATPase

Sequence
4546 bases(100 bases per row)
GACAGTGTGaCATATGGCTAGATGCGTGAAGAATGcTtCGATGCGCTCTTTCTGGGCTTGGCCaGATGCTCCATCtaGGTCACGCCACAACTCTGGTCCA
TCAAAGTTCAcGTATGGTGCCTTGTTAGCCGACGTTtCTGGAGGAGGTGGTGGAAGCGGCTTtCCcGATCGTTtGAGCgCAGCTAAaCCGATTtCAGTCG
TGCCGTGGCCGTATGATATTCCTCCAATGGAGCACTTCCGGAACTCCATGACGTTGCAAGTCAGCGTACCGGTTTtGTcaGAGAAGATGTACGAGATTTG
GCCGAGCTCCTCGTTCAGGGACATCGATCGCACAAGTGTTGGCGTGTCGGTCTCGGGGTAGTAGATCTCTTTGTCCCATTGGATGAACTGTGCCTGCAAA
TATTTTACCATGCTCATGGAGACCGAGAGTGAAATGGGCACAAACTGGTACATCAGAAGGAGGTAGTAGAAGAGCATCGTGATCCAGTCCACAACACCGC
TACTGTTGGACTCTTCGAGTCTTAGATACCATGGCTTGCCAGTGTTTGATTTCCACACGACGgAGCCTGTTGCACCGGCAGCACTGAAAATCACCAACAG
CACGAGCAGCACGATGATGTATCGGTTGATGGATTGATCCATCGTGCTCATCTTGGAAGGTGGAGCTGAGTTGCTCATCATAATCTTTGTGTCTTTGCCc
GTGTTGAAGACAACACCGTGTACCCAGTCCGTGTTCCTGATGATGCACCCACGCAGGATGACGCTTTCGTACGgAaTCGACTGCTTGTCGGTACCTTGCA
TTTCCAACACTCCCTGGAAGCTGTTGATCGCATTGTTTGGATGCTCGCATCGGATTATTCCCTTCATCTTAACCAGACTGTCTGTCGTTCCCATTGTCTC
CATCaTGCGTTCCATCGCCGAACGTACTTTCATGTTCGTTTCTCCATCCAGCGATTTGGTTTCAACATAGCACAGTCCCGACGGTGGTTGACCCGGAGGC
TCGCTCACCGCAAGCACGAGGATGTCGGCCGGCACTAGGTCGCGGTTATTGAGCTTGATCATATCTCCGACGACGACGTCCGCCCATGGCTTGGACACGA
ATGTCTTAGACTCTACATCCAAGACATGGgTGGGGCGTGAGTTGGCGACGCCGTCAGCAATGTGGCGTTtACGgtCTtCCAGCACAGCAAaaCaCGGCGt
CgaCCATGATGaTAAAGagCAATGGCGGCAGCGTGGACGGCTGACCATTGGTGTtGCTGATGGgCGGgATGCATTGAAatATGCAAATGAGGAGGAAGTA
GAGgTTGGCGAGTTTGCGGAAGGTCTCGAAGAGGAACTTGGGCACGAACGTCACGACGGTGTACTTGGACGTCACGATGAAGTTGTCGCAGTAGCCCAGT
TCCGTGTTCTTGGCCTTGTCGTTGAGATGCACGATgCGGAAGTcGCCCTTGGAcGCCGTCGTAGTCATGATGATGGCAGCGACGGACGGCCCCGGCTGGC
TCGGCGCGACGCTGGCGAGCTTCGTCCTCGTCTACGAGATGGCGTCACGTGGCTTGCGCGGATGCCGCGGCTGCGGCTCTGACGCGGGTCATGCGCCGTC
ACCGGGAGTTTCCACCGCCGTGAATAGCGGCGTCCCAGTCATTTATAGCCGGCGCCATGTCGGCTATtCATGGGCCACGATGTGACATAGGGTTACGCAA
GGGGTTACACTGGGGaCTGGCCAGGTGTATCCATCCGCGCGGATCGCAACGTGTGGCCGCGTCCGCATGGGTCCACACAGAGAAAGtCGGATCATATGAG
CGAGGAAACTGGGGCTATAGCGTCATAGCCCACACAACTCGCGATCTTTGTTGGGGCAGAGCGaCcTGTCCCACGtCAACTTCAACTTCAAATGAGCTTG
CTGTTCGACGCATACGAGCGTCGTATCATTTATCACTGTCACCATTGAGTAATGTATCAGCGACGTACTGGTCCGATAGCGATTGTCGCGGTTGCCTGCC
GCGTTCGAGCGACAGGGCTTCAGTTTGGCCACTACACGCGTCCGCAATaCGTCCACAGTGTGGACGCCCCTgTTCCAGTCGGCGTCATTTTCGATTTCCC
CTCCTagAGCTCACGTCAGTCGGAAGTCCGAGATGCATGTGGGGATTGTCACTCGGTTCGAAGGCTGTGTaTCGCGATTGCTTGAGCTGATGGACCAAGT
GTCATGCGCAGGAGTCGGATGGTTCACTGGTGGTCAAGCTTGGGGTCTTCGGTGAGATTGTCGGCGTTGCAGAGCGTAAGtaTAaGAAAAAGCGGGTGCG
AGATGAGAGAGTGGAGaTCTCGGAAGAGGATGTGAGAGCTGTCAAGGAACTAGAAGCAACGAAACGTCCAGACGCAAGCCGACTCAACGACGAGACgTGG
ATACGCATGCACGATATGATCGTCACTGCGAAAAGCCTGCGCAAAATGTGAGTCGActAGTCGAGTGTTGTTGAGAGTGATGACATGACGCGTATTTCAG
CACTCAAATCGTACTTGCGTTTTTCAAAGAGCAAGAAATCGCTCAAACCTCACAGACTGGACTGGGGTATCCTATCTATCCTGTCGCAGTCCCTGTcACC
GAAGTTTACGCGATGATTGGTCAGTGAGCGGCCGATTTCGATCAAGTGAGCTGCACTTTTCTGATGGGATACGTATCATTTCCGCAGCGCCACGAAAGCG
TCGAGCATATGACGTGTtGCACGTTCTTGAAGGTATTTACTCGCAAGATACTGTTTCTATCTCATTTCACTGTCAGCGCCTCCAATCAATCAGGTATTGG
AGTGTTGAAGCGAGTAaGTGGAGATGAAACGAAGACCGCCCGCACCCGCTCGGGCCACTTTTTGTACTGTGGCATTGCTGGTGCGATGAAGGGACTTGAA
AGCATCCAGCTACGAACTCACACTTTATGCGTCGAAGCGATTGCAAGCAACCCAACGGTGACCAGGCAACAACTTGAtACaGTGTTGATGCTATCGTGCA
ATGTCCAGTCTCAAATGGAAGGATGGCCACACTTGGCGACAGCCACAGTTGCTTTCTTGAGTCTCTTGATGGCAAGCAACAGTCCTGTCGATAACTCACT
GTGTGCCGTGAGTACCCGTGTTGTTGAGGCTCGTACTGGTGCTGAGAATGGGCTTGGcGAGGGGATCAcCCATGCTGAAGTGAATCGGCGGTTGTACGAC
GTCGTAGCTGTGCTCGCGACGGTGAACGTGATAACATTACCAACCCTTACTCAATCACTCAAGAGGAAGTGCAGGAAGGTCAAGGGACGTGCTACACCAC
GCAAGGGTGTGCTGTTTCACTCGGCCATTTTCCACAATCCAGCTCTACTGAAGATTGGAGACTCAGACTCTAAACGTCTTTTGCTGAAGTTTAAGAATGA
GTCTGATacGGTCGACCGAAGCAGTCTGGAGGAAGCCATACCTACAGACGTGGAAAAGATCGACCGTCGaGTTAACGAACCTCTATGTcATGTACTAGAC
AACGGGTGGTTCTCCCTCGATGATCTCTTCCCGGGATTAACCATGATTGAAgAcGTAGACTCCCAGATGGTCGAGTGGTGGAGCCTGCCTCTACGCGAgC
TTctACTCCGTGATGCACTAGACAGCGTCGACTTCCTCGACTGGGAGATAATGCAGGCGACGTCTCGTGCACAGAAGCGCATAAAAACATGTACTCCAGC
AGTCGCGCTACTCGAACATGAAGAGCATGTGGATTTAACATGCCACGAAACGCTGCTTGgTGCATAGGGATGTGAAGAGATCAGACGAACCAATTAGAGA
TCCTAGAGTGAAAGATGCATTGCCCATTTCATATCCACACGTGGTTATCTTTCTCTTCGTCTAGCGTCGCGtAGTtCATCCCACTTGCCACTCCTGAACA
ACTCAGGAACCCACTCGCGTCGCTGAGTCCATCGTCgAaGTCCTCTTCCTGCTCCTCCCCGCCTTCTTCCACGTtCCTGGCTCCTTCCTCTGTCTCCTCC
ATTTGCAGCTCTTCTAGACGCTGCTTCACTTCTTCCTCTGCATCCTTcaTCTTGGTCAACAGTTCCGGCGCCTCAACTCTGTAGAATTCATGAGCCACGT
CAGCACaCAGCTCCAGCTCGAGCCATTCCAAGCACCATCTCGTACCGATTCCTCGCGAGAGACACTCGGATCTGCGTTGTGATGCTCAGTGGCACGACAT
TTGtCGCCAAATTGAGCGTCTCCAAATACACGTTCACCTCCAATGCGTTGAGCAGCGCCTGCGCTCCTGGAGCCGCGATGCGGTTGTGCACTAAGCCGAG
ATACTTGAGAGTGCGGTTGCATCGGAGAGCACTCGCAAACGCTGTGGCCCCTACGTCTGTGATGGCATTGCTCCATAAGGACAAATGCTGCAACGACTCG
TGTCCGTAGAGGGCGCTGGCCAGTGCATTCGCACCGACGTCGGTGATAtCGTTGCTGCACAAGTCGATGTACTCGAGCGTCGaGTTAAAGCGCAGCATGT
TGGCGATGGCTACGGCACCACGATCGCCAATCGCGTGGTCGCGGAT