Description :
From Genome Similarity Track
Location :
contig_199:21597- 23215
Transcript NameFunction/comments
g14215.t1XP_009524664.1 Astacin, peptidase M12A family, neutral zinc metallopeptidase, Zn-binding site [Phytophthora sojae

Sequence
1618 bases(100 bases per row)
TGTAAACGATAAACTCGAACACGACTACAGTGGGTAGCGCTCTCACGGCTACCCGGACACGATGAAAGCGCTAGTGCTGCTCAGCTGTAAGAGATCTCTT
CGAAAGTGCAGACGACTTCTTGTTCTGGATCTGGATGGTGTTCTCGAGGTTTTCCCACCACTCCAGCATTTCAGCGACTGAGCCATCAGCGCTGCTACCT
TCGCCATGAACACCTCCAGGCTTGTAGTCTGAGTCTGACGTTTTGGAGGCTGAAGTCCTTGCTTGGCTGACGATCGCACTTCAGTCGAAGGGTTACTAGT
TGACGGCTTCGACGTGTGCTTGATCATGTCCGAGATGGAGTCTGGGGCGCCTACACTTCCAGCAGTCGATGAGCCACAGTTGGGATCTTCACATCACGCA
CCGTCGCGTTATCTTTCGAGCCATAGAGCATGCGCAGCGTGTAAATATCCCCAGCACTCAGCACCGCGCGTGTGCCAATCTCCACGTCGCGACTCGAGTT
GCAGTGCTGCTCCACAGGTTGGATGCAATTTTTCACCATTTCCACGTCGCAAAACGCTTTGAGCGGGTACTGAGCCTTGGGGAAGCAAAGACCTGCCGTG
CGGCCGTAGTGCATGATGGACTTGGGGTCGTACGCCTTGAGTGTCGCTTCTCGACTCGTCGTCTTGGCATAATTCTCAGCGGACACTGGCAGGTTCTGGT
CGGTGAGCACGACCACCTCCCGATCCGGGTGCGTGTGCTCATGGTACAGCCCCATAGCGTGGCCGATTTCGTGCACCACATTGCCCGGGCCGCCGGCGAA
GCAGCTCTGGCCGAGGTTCATCACCTGCGGCTTGCCGTCATTCACGTAGCCCACCATGCCGTAGCACGCGTCCTCGTTCTGCTCAATACTCACGTATTTC
CCGTTGCACTTGGTCACTGGTTCACACTCCTGCAGGGTCACGTTCACGTCCGCTTTGCTGTAGAGATCCACCGCCGTGTTGATGACCTCTAATTCGAAAG
CGGAGAAGGACCCGTTGATGCGGTACCACACGATATTGTCGGGCCATTTGTCCTCCTGCAAGATGATGGCCACGCCCAGTCGGCGGCGCCTAGAGGCCTC
CGTGCAGTCCACTGGGCGACTGTTGATCCACTGCGGGGCGTCCACCAGGCCGCGGTCCTCGAAGCAAGTCGCCGCCCCGTACAGACACCGAGCGTAGACG
CTGCCGGGCCGATGCGCGCGACCGACTAGATATCTTGCGCTGGCGTGGTCGATCCGGACGCCGTCGACGTCGCAGGCGGCAGGCCGCGCCCACGAACGAG
TCGCCGAGAGCAACAGCAGCAACGTCGACAGCACCTGCATTGTTGGAGACTTTTGGTGAACTGCTGACTACTTATCCGAGCGTCTGATTGGTTGGAACCT
GTCGACTCAGTATGGAGTTGTAGAGGTTCATGACAGACAAAAGGATGTAGCCATCACAAACAGTATTTGTAAGTGTCTCGATTGCATGTTGGGCTTCGTA
TCGTGCATCGGCGTGCTGCGAATGGTTGTGCTGAACTATATGAGCGAGTACAACCTTCATGTTAAAAGCCACACTCAGGGATAGCTACGTGAGTCAGCAA
TCTCGCAATCGTAAGATA