Description :
From Genome Similarity Track
Location :
Scaffold_107:215904- 221158
Transcript NameFunction/comments
Physo_142054reverse transcriptase
Physo_142055nitrilase, putative
Physo_142056hypothetical protein
Physo_142057hypothetical protein

Sequence
5254 bases(100 bases per row)
GAGAGCCGCGTCCATCGCGAGCTCAACCCCTCGAACCCAGAAGTGAAGGTTTTCTCCTTCCTTCCCTTCGAAGGGGTGAGCCTTCAGCCGCAGGGGCTTC
GGTTGCACCGGCTTCGGCGCGGCTGCCGTGGCCTGCAGCCCTTGAACGTGGGCGATGAGCCCTCGCTCGTAGTTGTCGAACGCGTTGATACGCTCAACCT
GCTCAGCCGGCGTCGCCGCCGCTAAGCTACGCAGGGCATCTGTCCCAAAGATGCCTGCCATCTTACGAACGGACTCGTACTGCGAGTCGTTCAGATGGGG
AAACTCCGTACGATCCATCTTGGCTCACTCGATGAGACCACAGAGGATTCAGGTAGTCCAATCTACCCGCGTAGGCGTAGGATTGACTACAAGTGCTACC
AAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATACAAACTCCAACTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGAC
TTGACTTGAAAAGCGGTAGATCTAAGACTGAATGTATTTATAGGTTGGTACAGATTTGGCCTGCATACAGATCCTAAGTTCTCTATAGTTTGTGTCATAC
AAAATGTATCTGTTGGCTCTGAGGCCACTTGGATCACTATCCAGGGGAGTGACCGATGTAGCCATTCCGGCATAGTGACAGGGTCACTATTCCATGTAAC
CCCGTTACAGATGACCTGCACGGGTAAAACTGAGACTCTAAATTGCAACGGTCGCGAACACGCCCTTAGCCCTAAGTTTGCTTCACTGCTTGCTAATGGT
GATTGATAAGATCAATTAGAGGGTGGGGACGTCGGCCTGAAGTGGAGACTCCACTGCAGGGTGTCGACCCCCTAAGCAACTCAACGGAGCAACGCGACTG
AGATGCTCCATTACTAGTATAATATTAATACCGAGTATTATCAACATTATATTCGAAAAATATCACTGATACCAAGTTAGCATTAGTCCCTGGTATTATT
GTGCCTTTCACTTATTCTGCCGTGATAATTCTGGCATAACTCTAATCCCTTATCGGCCTTAATTATGCCCCGAGTTAGCTAATTCCCATGTTAATTCCGG
GTCGCCCATTCGTGGCCGAATTAGGAGCGGCGATGGTGAGGCCGAGTTAAGGCGAAATAAGCTAATCCAGCCTGCGTTAGGCGGAAACAGAGCGATTGGC
GGTTTCCTACCCGCCAATCCATGCCATTCTGCTCGTATCTCCGTCGATTGGCTCTCAAATGCTGATCGCGGATGTTAGGGGAAGCGCTCACAATCTTAGG
CAGAATTAGCACTAAATAAGCGTTGATAGTCCTTTTATGACTCTAATTCCGCCTGAATTAACAGCTCACCCGCCAAAATACGTGAAAGACACAATACATG
AATCGTCATCACGGCGATTGCGTTGTTTGCGCGGCACTTCAACGGATTTGGAGTGTTTGCGCGCCCTCACATCAACCCGCAAAGATTGCGGCGCCGCGCG
TCGATGGTGTCTGTCGGCACAGAGGCAGCATGCTGCCATGCTGGCCATCTCCATCGAGGTGCAACCTGAAGTTGAACGATACTAGTGTTGCCATCGGAGT
CGGAACTTCCTCTATCACACAAGTGCACAGACACACCTGTGCCCACAGGCACGGCGAATACCTTACCACGCCGCCTAGTACCAGCTCCGGTAGCTAGATC
ACTCTTCAAAATCCATCGCCCAACGTAGTCCACTACCGAACGCACCATGGTTCTTTCAGAATCGATCGTTCGCGTCGCTGCCGTCCAAGCTGAACCCGAA
TGGCTCGACCTGCAAGCCGGTGTCAAGAAGACGTGTTCCTTGATCGCTAAAGCCGCAGAAGCCGGCGCTCAGCTCGTGTCCTTCTCGGAATGCTTCATCC
CGGGCTACCCCGCGTGGATCTGGACTCGGCCAGTGGACCCGGAGCTCACCGTCAAGTACATCGAGAACTCGCTCAAGGTCGACTCCCCGGAGATGCAGAC
GATCTGCGCGGCTGCGGCCAAGCACAACATCAACGTCGTGCTAGGGTTCTCCGAGAACGACCACAACTCGTTGTACATGGCGCAAGCCACGATCTCCGGA
GCCACCGGCGAGATCCTCATGAAGCGCCGCAAGTTCAAGCCTACGCACGTCGAGCGCACGGTCTTCGGAGAAGCGTCGGGGTCCTCGTTGATGAACGTCG
TGGATCTTCCGATCGGCAAGGTCGGCGCTCTCAACTGCTGGGAGCACATCCAGCCACTGCTCAAGTACCACACGTTCCTGCAGCGCGAAGAGATCCACGT
GAGCTCGTGGTCAGCTCTGGACCCGTTCGTGGATGGAGACGCTGGTCACTGGGGTATGAGCCGCGAGGGAAGTCACTGCGCTGGACAGCAGTACGCGGTG
GAAGGTGGGTGCTTTGTCATACACACGACCGCTGTCACCTCGCAACGCGGCATTGACATCATGAAGACCCAGGGCGATCCCAACTACGGCACTCCGGGAG
GAGGGTGCTCGGCCATTTACGGGCCTGACGGTCGTCGGCTGACTAAGTGGCTCTCGGAGACGGAAGAAGGCTTGGTGTTTGCTGATCTCGACAAGAAGCT
GCTCATCGCTGCGCGCACGCTGGTGGACAGCTGCGGACACTACAGTCGCCCCGATATGCTGTGGCTGGGCGCCGAAGCCCGCGAACGCAGACACGTCGAC
TATCAGGGCGCGCCGGAACTGAAGATGGAGAAGCCTGAGAAGTCGGACACTTCGAGCGAATCGAGCGACGACAAAGCAGGACTGGTTGGTCGGGGGCAGT
GACTGTCGGTTGTTTTTAGCTTGGTAATGTGAATCCTACTGCCTTGTCGTATTACTTGCCAGAGTCGTTCACTTACCGTATGAGTTCTGGTCCACATCTC
AGGGTCTGTAGGACGAGCATTTGTTTATAAAATTAGGATTTTTAAAAAATCCTAATTGTTTAAAAAAAAGAAAACTAAGGACCAACATGTAATAGGTTAT
TATAGGACAGGTTCCTGTACTCTCATTGGCCCTCGAGTAAAAGAACATTTTTTCACCAACAAGTGAAGTTATGGTGGACTCAGCGCCTCAAAAGAAGCGG
AAGCGGAAATACCGCAAGTCCACTCACGCCATTCTCAAGGTAAGCAGGGGGTGACCGTGTTTACTTCGAGCCCCTTCGTCTCACCGCTGCATGTACCACG
TGGCAGGAGGAGAAGGAGGCTCTGCTGCTGGAGATCGACACGTTGACTGCACGTCTCGAGGACCTCAAGACCAAAACCTTTGGAAGCCCTGATGGAGAGG
AGGAGAGGGACCGGCGATGCAAGGACAAAATGGTGGAGAACCGCTTATTACGGCGAGCTGTTCAGGACCAGCAAGACCAGTTCACCTCCGTCCACGCGCT
CACAAATGAATACTCGCTCACTGTAAGGATTTGATCGTGGAAGACTCGTCGGTTGTGGCACTAACAGGCACTGTACTTGTACTATTGGTAGGACACGGAG
GTGGGGAGCGCGCTGCATCGGTTCATCCACTTAGACAAGGGTGAGAGTTCTCGGCGGACTGCACTCAGGGCGATAAAAGACGGCGTGATCGCTCGCGGGC
TCCACCTGCTACAGCGCCGGAAACCCCAAATCCACCAACCGTGGCGACCGATGCACGACGACCACGCGTTCGAAGCGTCGATCGGTGACTACTACGCGTC
ATCTTTCGCCATCATGCCCTTCAAGCGGTTCAACACCGTGCAACAAGCATTCGCTGCGCTCATCACGTACTTCAGCAACCTCGAGATCAGCCGCTCCGAG
AATTTCGGCAGCGTGACCATCCGCGAGGACAACGACAGCTTCAATGCGGACGTCGCGCAGAACCGCCTAGTAACGACCACGCAGAGTGGGCACCAAATGG
AGTCGAATACGGTCTTCTTCTCCAAGCTCGTGGGGGAAGGCAGCGAGATAGGCCAACAGCGCGGATACGGGATTGTTGTTTGCGACTTTGTGGATGAAGA
TGATCGGTACCCCTTCCACTCGGAGGCAAGAGTTCGGAGAGACTTGAGCTCAGTCCTGGAGATCAGCTCCTACGTTCGGCAAAACCCGACAGGGGCCAAG
GGAGAGCAAGAAATTGTGGTGGTTCTGACACGATGGGTCCATACACGACTGCATTATCCTGGCTTCACGATACGTCCTGACGACTGGGACGAGATGTGCC
AGAATACAGAGCGGTGGATGCAGCTACTGCGGCCGCCCTTATTGGAAACACTGGTGTAAGGTATGGCATGGTAATACCGTGAACGATGTGAAGGGCGATC
ACTGGCATCGTGTTAGCTGTTATGTGATGCTACGTGCTATCGGTAGTCGCAGTCTGAATTTTCGGAGAATGGAGAGCCACGAAGTCTTGACCAAGCTTGT
CATGGTTCTGGCTCTGCTGCTGAGGCGAAGCAGCCTGGAATGGTTTAAGCAGTTGGCTGCCGTCGGAGCTTGAAGTACACACCTGCAGTTCCAAGTCTTC
AACCTCGACTCCAACTGCTTGCTCCGCGCGAGACTTCTTGGGGTGATAGATGAAACACAACATCATCTGCATAATCCCCAGCGCGGCACCAGCGGCATTT
AGGATCATCACGAATTTGTCCGGGGCGAGAAGGCACAGCACGACCCAGAGCAGGCAGTTGACTGCGTTGGCGAGACACATGTGAAGGGCAACGACGCAGC
GGACTTGGTTTGCACGACCTTCCCGATAGTCGCCAGTGGTGATCCGAACATTGCGACGGACGTGACGATCGAGATCCACCCGACAGTCGTGTTGACTCCG
TGACGAGATTGGTGCGTGGCAGACGTTGTCAAAGCGACGACGGTGTAAATGATCACCAGCACCACGATGAGTACGCTGACTGCGTACACTCGGCGGACGG
ACGCGCGATCTAAAGAGAACTTGTAGAAGACGCCGATGAATACGACGGACGTGATGACACCAAACACCGAGATCGCGAACAACGGGAAGAGATAGCTATA
TATCCCTTCCGGACATAATATGAAACACTTCTGGGGGGTCTTGCAAAAATGGCCTTGGAACCAAGTCAAAATGTTTTCGCGGCCGCTAGGGCACATCAGG
GCTAGAGGAGATGGCGTTGATTTTATCCGTGGCAACCGCGAGGCCCCATACCAAAAATTGAATGCATTAACGCTACGGACAGGAGACCCATAGTAATCAT
GATACTGTTAGAAAAGGCAATCAGGACATTATGTGAAACACAAGGAAAAACGAT