Description :
From Genome Similarity Track
Location :
Scaffold_317:2159- 6994
Transcript NameFunction/comments
Phyra_85803predicted protein
Phyra_85804Hypothetical protein
Phyra_97175unknown
Phyra_858063-oxo-5-alpha-steroid 4-dehydrogenase, putative

Sequence
4835 bases(100 bases per row)
GTGATTGGATGCCAGAACCGAGGGCGGACTATCGGCTGGAGAATGGCGGCGCCGTCCTTCTATGAGGTGCTGGGCGTGGCGGCGACGTGCAGCGCTGACG
ACGTTCGCCGCGCGTACCACCAGGCGGCTAGGAGATGCCACCCGGACAAGCGCTCGGCCGCGACGGAGGAGGACGAGCAGCGCTTCCTCCGTGTACAGGA
GGCCTACGAGACGCTGCGGACGGAGGAGCAGAGACGGCAGTACGATGCCAAGCTGCTGCAAGACGAGCTCGTGCGGAGGAGGGAGCAGGAGCTGGTCATG
GTGTCCGATGAGGTCCCACTTGCAGACATGAAGCGTGAGATCCTGCCGGGCGACGACGACGACGAGGTGCTCTTCACGCATCAGTGCCGCTGTGGTGATC
TGTACGAGATCACAGAGGATGAGCTACAGGACGGCGTGGACGTCGTACCCTGCACGGGCTGCTCACTGCACATTCGGGTGCTGCATGCGGTAACAAAACA
ATAGAAACAGTAAATGCCATGCCGGCCATGGGGAAATATAAACCTTTCATTTGCATGTTTCCTGTCCGCGATGCCCTTGCTCTCATTGCCAATCATACGA
GCCAGAAGCTGCCGCCTTAGAACTCCTTGCCGCGCGGCGCTCCGTGGGACGGGTATCTTTGCGGGGTCTGGATCTGGTGGAGCACGCCCAGACCAATGTA
GGCCATAAAAATGAACAGGAGACCGAAAAGCAGGCCCGCCATGATGTCGGGGGTGACGTTCACGTAGTGCGAGAAGCAGAAAGCCCTTCCAGCCGCGCTG
TACCCGATGAGGTAGCCCGCTTCACACAGAATCGCAGCTTCCGTCGACGAGTTCGCCTTGGCCTTGGTTTGAGCGGCAAGACGGCGAGCGAGAGGGTGCT
GAAGTTCGACCGAGTCCGCGTCGTTGCCCGTCAGAGCAAAGTCCGTCTTGCTACCAGTGGCTGAGTTCAGGCTGCTGGAGGCTGCCTGGATGGCGGCGTC
CACGTCAGGCAGCAGCATACTCTCAGGGAGCTGCACGATCAGCAGGTCCGTCTTGCCGTTGGAAAGGAGCGCCCGGCCTTCCTGAGAAGCAATAAACACA
GCCAGATCCTGGATTCCTACGATATGAGGCTTCGTACTGGCCATCTCGGGAAGAAGCGGCTTGGAGCGCGTCGTGTGAGGGATCACCACCGACGACCTGG
AGCTCTGGACGGCGTTCTGCACGAAGGAGCCCTGGCCGCCTCCTCTAGCGAGCTTCGATACATCCTCCGAGGCCAGCGACGGCAGCAGGAATAGACACAA
CACCTCTGCCTCTTGGAATGATGAGCCCTGAGCGCTCAGTAGACCCTGGAAATGCCACTTGTTAACAAAAAGGAAAATGACCTGTACACCACTAAAACCT
AGCGCACCTCCTTGTCAGCGCTGGCATCAAGCGTCAGCACGCGTCCCACGGCCGATGCCACAGCGGCTTCGTCCATCTCGGAGCTCAGGTAGGCGTTTGA
CCCAGCGAAGATCCTGCAGACAAAACTCTGTAAGATCCAGGGGTCGCTGTATAAAGTGCTGACAGGCAAAAGGAGAGGCGAACGCACGGACGCTGGGACC
ACATGACGAGCGGAACATGGGGGAACAGAGTGGAGGCCGAAACGGCTGACGTCGCAGCCGCGAGGCCGCACAGCGTGGCGCCCAGCAGCGTCTTCATCAT
CGTCTACTTTGTCTGCTACTTCTCCGCCGCTTTAGATCGCGCTCTGTCGGTTTCTGTTTTTACGGCTTGCTTGTAATTTATGGCTTGATTTCAGTATGAA
TATTCCTTAGGACATCTGATCTTCTGTGATTCACTTTAACCTGGGTTCAGTATGCCATTTCGTACTTTAAATAAAGGCCAGACTCTCCTTTTCCAGCGAT
TCGTGGCTCACTCCAAGAAACCCACAGGTAAGACGATTCGCGTGCTAGTCCCGGACGAGATCTCTGTCGCCCCCCCTGCGTCCGTGTTCGATGTGCTGAC
TACCGCTTCTCGTTGCTCTGTACGCAGCCCACTGCCGTGCAATCCCCCTCCCTCGAAGCCCAAGATGTCGTCCATCCTAGCGTCCCTCGACATGAGTCTG
GACGACCTCATCGCCCGCAAGAAAACCAAGCCCAGCAACCCGGCCTCGCGCCCGGCCAAGGCCAACAAGGACAAGGATCCCGCAACCGGTCCCATCCGCA
GCGGTCGCCGGCAGAACCGCGGCCGTAACCAGCCCTACTCGCGACCTGTAAGTGTTGACACGACGCTTCAGTCTATTTTCTCTCTATCTTTTCCGCCCTC
CTACGCTGCGGAATGGTAGCCCCCCCATCTCTTCGGCGGACAGATGTCCGAGCTCTCGCTCCGGGGAGCATGGCGCCTGCCTGTTCGCGTGCGTTGAGGA
CGGACGTTACGTTTGGTGCAGAAATTTACACGTGCAATTGTCTCCTGCGTGTACCAAAGCGCGGCGGTAATGACGACGATATGGACATTGACCTGGATGA
CGCCCCCGACAGCGGCAGCCGCGGTGGCAAGCAACGCTCGGTTGTTGTCAAGAAGCCCGGTAAGGGCGACAAGAAAGGTGCGACGCTGCTCCCTGCTGCG
CTAGCTGAGATGACCAAGATTTACTGACGCATGGTTGACGATTATCCTGCTGCATAGGCTCGTCCTCCATCCTGTCGCGTCTTGGCGGCAAGGATGCGGC
CGGCCCTGGCACGAAGATCCTGGTGAAGAACCTCAAGTTCGACATCCTGGAGGAGGAAGTGCGCGAGCTCTTCGGCACGGTGGGCAAGGTGTCCAAGGCT
GAGATCGTGTACGACCGTTCTGGTCGATCCAAGGGCATCGCTCGCGTGTGGTTCGCTCGCCGCTCGGATGCTGACAAGGCCATCAAGCAATACGACGGTA
AGTATTGTTATTTTGGTGTGTGTGGAATGTCTTTTCACGACGACTTAATGTGTTGTGCTGGCGTTGCGTGTATCGATCGGTAGGACGTACTTTGGACGGA
CAGCCGATGCAGATCGCGCTGGACGGTGACAAGAATGTTCGCAACGGACTTTTCGGCACGGCACTTGATCGTGACGACAAGGATGTCCGGTTCAAAGTCT
CGTTCGGGTATGTGAAACGCCTGCCGATTCGTAACATAGGAGTTGATCGTGGTGTCTGACATTCATGTTCGCAGTGCTAACAGTGGAAACAACGAAAACG
ATCAGTCGAAGGGCCGTCGCAACAGACGTCGTGGACGCGGCGGTCAGGGTGACAGAGGCAGCCAGGGCGAACGTGGCAGTCAAGGGTACGAAGCCATTTT
CGTGGGTTTTGCTGGTATGCTATTCTAAACGCAGTGATTTGTTCCTTTTTGTGCTGCAGCGGTCGTGGTAAGGATTTAGCTTCGTCCAAGACGGCTGAGG
ACCTCGACAACGAGATGGACACGTACATGAAGGACGCGTAAAGATGAGGCGTGGTGCATCCTGCAAAACGGGTGCTTGATGCGAATCTATACCGCGACTA
TGCATAGTTGTTCTGGTACATTGCATTTAACGGGTGTGCGTGTGGTGAGCAAGGGCTTGAGCTCGTCACCTGTCTGACAGATCGAGCGAGTCGTTTGACG
TGCCGCTGACACCTGAGATATTGAATAAAGCATCTCCATGACCATGAAAAACGGATCCCCGCCAAGGTGTGCCGCCAGCGCAGTGCAACGCGAACTACCA
AGAGTAATGTGCCGGCATGTTCCCGTTTTACTTCGTCTTTTCTGGATTGGTTGGTCAAGATCACGTCAAGAGTGCTGTGTTATCAAGCTTTGCACAACAC
GGTCTGTGTTGCACGACCGAGGTTTTCCAGTTCGCGGGAGTCGACAGGTCTTCTGTGGTACTGGTAGAATGTCACTGGTAGACGGTTGTAACTCACATAG
TGCCGGTGATGAATCCGTTGTGCTTTTTTTTTTAATAAATAGCGCAACTGAGTCGTGAACTTATCGAGCGAACGACGTTGACGAAGGCAAGATACACCAC
AAGCTGATTGGCCACCAGCAGACTTGACAAATACTACGATCAGGACGAGCATGCTGGGCATCGAGACGGAGGAAGAGCTGCATGGCTGGCTCGTCAAGGG
CGTTTTCGTGCTAGGCGTGGTTACATATATCGCGACGAGCTTTATCACTGCTCCGTACGGACGCCACGTTCGACCAGGATGGGGGCTGACGGTGAACACG
CGCCTCGGCTGGGTCCTGATGGAGAGCCCTTCGGCCGTTTGGTTTGCGATTGTGTACTCGTGGGGGGAGCACCGTCTTGAGACGACCCCCCTCATTGCGG
CGAGTCTGTGGGAGTGCCACTACGTCTACCGCTCGTACGTGTACCCGTTCCTCATCCGTACCAACAAGGACAAGGGCATGCCGCTGACTGTGATGCTCTC
TGGAGACTTCTACAATATGATCAACGCTTACGTCAACGCTCGGTATTTGAGTCAGTTTGGCGACTACAGGTACAACGAGGATGAAATGCTTGCTCGGCCT
TCGTTCTACGCCGGAATCGCTCTCTTCGTCTTCGGTTTGTCGATGAACATTTATTCGGATCAGGTGCTGATCAACCTGCGCAAATCTGGCGAGTCGGGCT
ACAAGATCCCCCACGGCGGTTTGTTTGAGTACGTGTCGTCGCCTAACTACCTGAGCGAACTGCTGGAATGGGCGGGCTGGGCAATGTTGACTCAGTCGCC
TGCGGGGCTTTCCTTCGTGGTGTACACCGCTACAAACCTTGTGCCGCGGGCGCTGAGCAACCACAGATGGTATCAAGACAAGTTTCGCGAGGAGTACCCA
GCAAGTCGCCGAGCGATCATCCCCTTTCTGTGGTA