Description :
From Genome Similarity Track
Location :
Scaffold_3:2158755- 2166846
Sequence
8091 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTTAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTAAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTCCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCG
TGCTAAGAGTTGGGTGTACACTCGGGAAGCAACAACCCCTGGAAGTTTAACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTACCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAATAAAGGAAGGCGCGAGCTGCACGAGTATATGCAAGAGATACGGGAGCTCACGGCGTCCC
TAGTGGGAAATCCATTTAGCGAAGACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCTCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCT
CCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGAGGGAAGATGGGCCACTTCA
AGCGCGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGC
AGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAGGAACTAAGTCGTCGTGATGGGTGCGCAAGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTC
TTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACGGATGTGTACGGGGATACGATTATTCCTCTAGAATCTTGATTGACTCTGG
GGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTG
CGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCG
ATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGAATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGC
GCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGTCAGGGTACCAAAGCATCCGGCAGATGCTTG
GGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGACCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTA
ACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGA
AGAGGAAGACGTCGAATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAGGAGGAAGGCGTTGAACACGCTTCCTGT
GTGGGTTACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCA
CGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGACAAAGACGCCGCCGCCGCCTCAAGTC
GGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGATTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTC
GATGGCGAGACAGGTTTCCCCGTCAAGGCATCTGGTGTCCACTTGAAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGT
CTTTCCTGACCAACCTTAAGGCTGGCGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGAAGCTGAACTCCTCCTCTGTCTTGGACGA
GAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTAC
GCGGACGTGGTGAACAAATACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGA
GGCAATGGCCTCTCCCGCGGGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTC
GACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGAAACGGTGCCGGCCCAAACACCGATC
CCGAAAGGATGTGTTGCTGAGCAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGAC
ATCCCGCTCACCGCGGTAAGCATTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGG
TGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATATCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGT
GCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGCT
CTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGACCGACGCCCCGATCCCAGAAGGATCTTCGAA
AGTGGTTAGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCG
CTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCAGCAAGGCCAGTCTTCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTC
GTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAG
CCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGT
GATCTACACAGACCACGCGTCCTTGAGGACAGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCTTTCTTCGCGGAATACAACTTC
CGCGTCGAATACAAGCCGGGCAAGCTTAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATC
TATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCACCTATCGTCAAGCTCCTTAAGGCTGGAACGAGCGCGAAGTCCGACTGGCTCTC
GTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAAC
GACGAGGATCGGAAGTGTGACAACCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCGGTCCT
TCTGGTGGACCCTGGGTCACCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCG
TACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCGCGCCGACGGACACAGCAACACCGGAATTTTGGTGTTCGTATGTCGGCT
GAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTTGATGGCGTGTTCCGCTATCACGGTCTCCCG
GAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATC
ATCCGCAGACAGACGACCAAACAGAGCGCGTTAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCT
TCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACT
CTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGAGGAGAGGCTCGGAAAGCCCTTTCCATCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAGC
AGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACA
AGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTGCTAGACACGAGGAGCCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAA
CTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCT
ATGTCGGACGTCTTAAGCGGTACTTTAACCCGCAGGGGGTTGCTGACTCGCAGACCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCG
ACGAGGGCGTCGGAGCGTGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCC
ATACGCCTGGTACGCTGAGAACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGT
CGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTTGCTCCACCAGGTCCAGGCGAC
CCGCAAGACGAGCGAGCTCGCCCTGATTCCCGACCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCTAAGTGCAATCTCAAGCACGAGGACACGTTGACG
GAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGC
ACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAG
TGGAGGGGTCATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGC
AGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTC
AGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGA
GTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCA
GGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAACACA
CACCGAGCAGCCTCCAAGTTGTCGACGAGCAACTGTTCTTTCTGAACAAGGGCTTGTTCATAGATGCCCCTAAAAGTGTGGCCGCCAACAAGGCCACAAG
GAGCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGTGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGTTGACGGGTGCCGC
CACCGAACCCCCACGCACACGCTGGGCAGCTTATAAATCCTACTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATACACCCTCCTCCT
CCTCTTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGA
GGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCC
TCATCGCCACCGGCTTTGGGAGCGCATTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCG
ACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCTTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCTTC
ACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGTGCCTGCTTGCGCGCTTGTCCACA
GCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCT
TACCGGCAGCAGCCTTGAAGCGTGTCTTAGCACCGCTCGTAGCAGTGCCACGAGGCATGATAACGGTCGAAGCGGAGACCTAGACACTGAGCGCACAGGT
TGCTGCTCGAGGCTCTAACTGTGAAATGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCT
CTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCTTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCA
CACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAG
GTAACTTATAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAG
AGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAT