Description :
From Genome Similarity Track
Location :
Scaffold_32:215873- 219392
Sequence
3519 bases(100 bases per row)
GTTCAGCAGAGATAGTGGAGCGACTCTCGGCGTGCTGAAGCCTGTGGTGTGAGACTTCATTGGTGAAGTGTGTGCAGAGTTCAACTCTGACGTTGATATG
GTGTTTCGAGATTGCTGTGGGCGAGTTGGTACGCTGAAATGGATCATTGGTGACGTGGTTTTCCAAAGACTTTCAATTCCGCAAGGGGCGACGTTCGATG
TCCTAAAGATCATTCCACGAGTAGCGCGGTACGTCCACGTACGTCGAGGTGTCAAATACCCCAGAGCTTTGAAGATCAAGGCAAAGGCAGCGACTGCTAC
CAGGCATAAGCGCACTGTCTTGGAGCTACCTCCATAAATGTACGAAGATATATTGTAGCAGCCAGCAGGATTCGATGATTGGACGATGTCCATTGTCTGA
CCGCCATCGGGCATCTGGAATACGCTCACGATGTCCATATCGCGGTAGCGTATACTTTTGTACGGCCCAAATACCGTAAGTGAAGACGTGAAGCTGATGA
GGAGACCACGAATGCCAGAAATCCCTTCGTCGTAATACCGCGACCTTCTCATCGCAAACAAGACAACACTCGCGAACAGAGCTAAAGACCAAACGCCACG
CATTTCCACCGATGTCGTCCGGATGAATGGTACCAATTTGAAGTTGACAGCGCCTCCCACCGAAGCCCAGTACGAGTCGAGAAAGATGTCGGTAAAGCTG
CTGTCCAGGATCAGAGCCCCCACGTACGCACTCACTGGCAACAAGCTGCTGTACACGATAACCTGGAACGGGATTTTGAACACGATCAAAGCGGTCGACG
CGAAGCGCGAACTCGAATTTAGCTTTTCAGCAGCAGATTGCCCAGACGCTGTGTACGCGCCATACACTAGCAACAGCAAACGGATCCACACGTAGGTTTG
AGCTCCGCCTCGCAGCATCGCGATGATACCGTACCAGTCGACGAGACTGGTTTGGACGATATCGCGCTCGTAACGGTAGTCGTCAACGAAGACTGTACTG
CACGTGGTGACGGATGACGAGTTCGTGGTCTTTTCGACGCATCGCCTGCCACGCGTGAGCGTGACAATTTCCAGCGCCTCGTAGTTGTAGAACGTTGATC
TCATCGCCCCCGATGTCGACGAAAGTCTCTGCGACGACAGTAACGCAACATCTAGTTCCAAGTCTGGGTAGCGTTGCTGCAAAGACCGAAGACGGAGGTC
TATGTGATCTCGGAGGCGAACGACGGGCAAGGAATCATTCATCGGATTTCTGCACTTCCAAATGCCTGGGTGGTTGCAGAAGCGTGGTCGTGGCCAAGAG
CGTTCTGCAATGCCAGCGGGGGCGCATATTGCGAGTGACTGTGCTTTGGTGGATATGCGTCTCACATGAAGAGAGTGCAGTCTCCATGCTGGGTTCTTGG
TGACAGATCGTAGAACGTACTGGTGCAAGCGGTCGACCCAGTTGTGCAGTGTGGCGAAGCGCAACGTTGCAGAGGAATTGTCGTCGAGCATAAGTTGCGT
GTGCGCGGCCGTGATGAAGGCGTCCAGCATTGTGAGCGCAGTACCGAATTCGAGAAGGCTGTTAACATTCCTTCGTGGTTGGCCGGGCTGATTTTTGTAG
AGCAGGAAGGACGGGAACTCGGTCACGTTGAGTAGCTCTACTGCTCCTCGTAGCCCGACGGAGGTTGTGTCGTATTGGTACGACCATACTCGAGCTGCAG
AAATTGATTGGGTGCCCTTAAGACCTGCAAGCTTTGCATCATTATCGCCAGTACCATTGTCTAGGCGCCAAATATGCAAGACCGGGTAGTTGAAGGGTCC
GAAGCGAACTGCGGTGCTGGGCATGAGCGGAACGGGGTAGTACTCCTGTAAGTTGAGTACACCAAGACCCGTACGCGGGATGTCAGTGGCAAGGAGAGCG
AGTGATACGAGTGTGATGACACAGCGCAGTTTGGAGAATGCGATGCATCCGGCGATGTCCGGTTGCGGAAGGAGCTTCTTCCATCCTCGCGTCCTCACGT
AGGCCAAAGTTCTGGCGCTGGAGAGTTTGCTGGAGTTATCTGGTATTCGAGCTCGAGAATCACCGTGGCACCCTGGTGCTGACGGGTGGATTGATGGCAT
GACTCAGCTCCGAGACGTGTGCATGGGCACTTGCAAGTCTGCTGTGACGTGGTGATCTATATCAGCAATGCTATAACGGACGTGCGATTAGGACTCAAAT
CATGTTGCGCCGGTATTGTTATTTTCCACTAGTCAATATGTGCAACGCCTACGTCGGAATGCCTTTGGAATTTGCCGACTCAAGGAGCTGATAACGAGCC
GAACTCAAATCTGTGTACTCTTCCATCTCATCTGAGGTGCGGCAAGGAAATCCGTTTACGCAGCAGAGGGAGCGCGCGTTTGCCATAACGTTTGCTGTTG
TGACGCCACGAAGGAGGCAGTTGTATGACTGGCTTGGATAAGATGAAACGAGTGAGAGTGGAGTTGACGAGTCCGCTGCAGTGCTGGGCATTACCGGAAC
GGGACAACATTTTTGAGGTACGTTGAGCTCACCAAGACCAACACGCTGGATGTCGGCGACACATAGAGATGGTCGATCGAGGAAGGTCTTATCGATCTGC
GTCCACCTTTGTTGATCTCCGCACTTGCTCATTTGATGACTGCACTGCGATTACATTTCGATTGGCAATGCTTAGTTGGGACTCAAATTTAGTGGACCCC
TTTGGCTATTCTTCCCCAGCTGCCCTCGATAGAGGAAGTGATCCGGATAATCGGTCACTTTGAGCACCCCGCAGACCGATTGGAGTCGTGTCGTAATGGT
AAGACCACACTACTGGATCTGCCTCATTGAGGGCTTTGTGCAGTTGGATTATCGTCTTCCACACGCCAAATGTGCTGCGTGGGTAGTCTATGGGCGAAAA
CGCCCGGCAACCAGAGCTGTGGAAATATTCACTGAGACTCCTGACACCAAGACCCGATCGAGGGGTATCCGCGACCTGTAACACCAGCGAAACGATCGAG
ATGACATAGTGCAACTTGGAAAGTGCGAGACAGTTGGCGATGTCAGGACGAAACGCTAGATATTGCCGATGATGAACTCGTGCTTGTGTGCAGCTTCTGG
TGCATGGTTCTTTGGGGTGCGGGGATTCGGCTTGATCCTGATCATGTTCGCATCCAGCGTGAAATAATCGTAGACAGGAAGTCCTGGCTTTCCATTTACG
GCCTACGAAACGGGCCCGTGTGAGTTGAGTTGGCGAGGTTATATGGCACCACTGCAAGTTCGAGTATTACGAGTCTCGCAGCAGCAACAGACTGAGATTT
ACGAGAACGGTAACAAGAAACAAGTGCCTTTCGTTTGGACTTCGCGATCAAAGTGGCCAAACCGTTGCGGATAATGTTGCGGTCCTCTACGCATTCGCAG
CATGTTGAATGACGACCTGGCCCATTATTTACTGTGGAATATTACAACTTTGTCGGGTGCTGCTATGTGAACCACGATGTGTCTGAGTTGACTGTGCCAG
TGCAGCCGCCGCACCTCCT