Description :
From Genome Similarity Track
Location :
Scaffold_3:2158602- 2161671
Transcript NameFunction/comments
Physo_299909spermatogenesis associated 1
Physo_492739conserved unknown protein
Physo_314481translation initiation factor eIF2B beta subunit pu

Sequence
3069 bases(100 bases per row)
GCGGAACTTCACAGAGAAGGACGAACTCGGCGGTATGCCGCTATCCCACAGCGAGTTTTCGTCTTCTCTTTCTTCCGCCAAGCGTCTCAATCTCTCATGG
AAATCTTCGTGGCTGCGAAGCACCTCTCGAAGCGCTGCCTGATCCTCTTCCAACGCGTGGGCCACCAGCGACAGCTCTGAGTATTTCTTCTGCAGATCTT
CCATCGATACCGCTGCCAGCTCACCATTAGAGCTAGAGTCCCAGCACTGCGTCTGCTTCCTTTTGACGATTTCAGTGTACACATTTTCGAGCTGCTTGAC
CTCCTCTCTCATCCGCTTGAGCATCGCCTGCCTCCTCTGTCTCGACTTCTTCTCAATAGCGGAGCGTCTCGCTCGCTTGGCCTCCGCCGAGTCCTGAAAA
GCTTCAGACGGTAGATCAATCAAGGAATTAACGGGGCTCATGCGGCCGATGTCGTCCTGGTTCCGCGGCGCCGAAGGCGGCGGCGTGGCCATCCTCAAAC
TCGTCGCCTCCGCGTCGCGGACCTTCTGCAGCAAGCGCTGCGGAGTCGCGGTAGTCTCTTCGAGCTTGACGACGGAAGGCTCGTCGTACTTGTCCAGCTC
GGACAGATCTTCCAGCGCCTCCGAGAAGGCGCGCTCCGTCGTCGGGGACAGCGGCGGCAGCGCCGCGAGCTGCAGCTCATCCATGGCCTTGTCGTCGCCC
TGCATATAATAGCACGGCACTCAGCTATACCAGCACTGACTTCTACGCTTACGAGGCAGTAATCGATCTGTCGATCTGGGGCTTGCGCACTTCTGACCTC
AAGGCAGAGAGCAGTTATGGCGCAAGTTGCCTTTTCGTCAGAATGATGGTCAGTCGGACCATGTCCCGTATAACGAAGTGGGTCGTGAAGAAGTTTCTTG
TAGAGAGGTGAGCCAAACGTATCAGATACATTGTATCCAACAGATCCGCAGGCGTAATGGACCGAGTGATCACCGCCGTGTCGGCGCCCACGACGCACGA
AGGCGTGACATCCGCCGTGATTGCAGAGCTCGTGTCGCTCGGCCGCAGCTCCGTGGACCGCTGTCCGCACGCGGACGCGTTGGCGCGCGCTCTGGCCGTC
GTCTCGCAGTGCTACAGCGTTCCGGTGCCGTCCAGCGCCGCGTCCGCCATCCAGAAGGCGCTGGCGGACGTCTCCGACCTGCTGCAGCGCCACCGCCTGT
ACGCAAATGACAGCAGCACTTCAGTGGTGTACAGGCCCGAGCAGCGTGCAGTGATCGACAGCGGCGTGCGCTTGTTGTGGGCGCATGTGACGACGTATCA
ACTGCACGCGGCGCTCGTGGACCTGGTGCGCACCATCGACTTCATGCCGCGCGCAGTGGCCTTCTGGAAGCAGTTGAAGAAGAGGACGGTGCGCGAGATC
CTGCAGAGAGGGCCCATGCAGTGGCTCATGACGCGGGCGCAACGGATCACGGTCGGAGAGAGGATCCGCAGCTTGGAGGAGACGCTGGAGGCACATTTGG
TACGACTGTGGACTGGAGTGCAGTGAGGAGGAGGATATAGAACTGATGAAGTGGGTGTTTATTGGCGTATGCATGTGTAGAGGAAGATTGGAATGCTGAA
GGAGCTGACGACTAGGTGCTCGGGCACGTTCGAGGACTATGACCAGTTGGCGGAAAGGATGAAGGAGGGGATGACCCTGCTGGAGCTGGTTTACAGTACA
AATGGGATCTGTCCGCCTCGAAAGGGACAAGGCGCGTTTAAGTCGCAGGATCCACTGATCTTCACGGCGTTCTACTTTGGTAGGGATGGAGAGCTATGGT
TGGGTGTGCAATGCTTAGGGGAAGTGACTAACGAAATGGATGTCCTGCAGACGAAAACATCTTTGAGAAGGGCTGCAATGGCGTCATATCGAGTGAAGAT
GTGGTCAGCTCGTTGCGCCGAGTGGAGACGAACCTGTCGGTGTTCCGCACAGCACAGACGCAGTTCTCGCGGTGCTTCCAAGCGGCTCTTGCGCCTTGCC
GCCCACCATCCAAGATCCGTCAGCGATGGCTTCAGGTTACCACCGTGGCGATCTGCCTCACTGCAGGAGGCTTCTGGGTCGTGAATAACCAGGATGAGTT
CCGGGCGGGCATCGCTGCCATGCGTGCGGCACTGCAAGAGTTCTTGAATGAGCACATGGTGGAGCCACTCCAGGCCATCTTCGGAGAAGTGGTGCTGAAC
CAGAAGCCCGAGATCCAAGATGCTATGGCGTTGCTGGACACAAAACAGAGTCTGCGTCGTATGCTGTCCGACTTCGTCAAGGACACAAACCCCAACGTTT
CGTCGGCTGAAATGAACCGCATCATGGATGAGATGGACATGTCCGTGGTGTCTCTTCAGTACGAGAAGCAATTGGCAAGTGCTGTAAGGAACTTGATGAC
GGGTGATATCGTCCGCATGCTGCTGATCCAGGTGCAGTTCATCAAGAAGGAGCTGATGGTGGCAATGGGTGCGATCGACGAGTTGATGCACGCGAACCAG
CTGAACCTGCAGATACTGGCCACGATCCCAACGTTCCTGGTCTTCGGTGGCCTGTACAAGCTGGTCACGTCGGCCTTCCACATGATCTACAAGCGCATGA
GCGACCGACTGTACTACGACTCGAGCGAGATTGCTGGGTTCCTGCGCAACAACCTGCGCGACATCGAACGGCTGCTCAACAAGCAGAACCGCGGATCAGG
GGCGAGCGATGAGGCTGTGCTTGGTGTCCGCGAACTTGGGTTCCTCATTTTGTTGCTGCACCAGCTGCGTGATCTCTTCGAGGCGTACCGCGCGCTTTTC
CAAGAGGAGGAACAGGAACGTTTCGAAGAGGACCTGGACGATCTCATCGGCGAGGGACTGCTGGTCTCGCAGCAGCTCGCGGTCATTCAACGCATGTATC
ACTCGCACCCGTTTCTATACAGCACCAAGCCGAACAAGTCGCGCTGGATTTTGGACTAAAAAGAGCAAAGCGTCTTCTGCGTATTGGCATCACATCAAAC
AAATCTAGCTGAGCTGGTAGTCCTGCGGCGAGTAGTACTCGGCGAGCAGACGGTAGATGTACGACGGCT