Description :
From Genome Similarity Track
Location :
Scaffold_156:21584- 26141
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.17Phospholipid-transporting ATPase

Sequence
4557 bases(100 bases per row)
tGACGCTCAGGGATGACAGTGTGaCATATGGCTAGATGCGTGAAGAATGcTtCGATGCGCTCTTTCTGGGCTTGGCCaGATGCTCCATCtaGGTCACGCC
ACAACTCTGGTCCATCAAAGTTCAcGTATGGTGCCTTGTTAGCCGACGTTtCTGGAGGAGGTGGTGGAAGCGGCTTtCCcGATCGTTtGAGCgCAGCTAA
aCCGATTtCAGTCGTGCCGTGGCCGTATGATATTCCTCCAATGGAGCACTTCCGGAACTCCATGACGTTGCAAGTCAGCGTACCGGTTTtGTcaGAGAAG
ATGTACGAGATTTGGCCGAGCTCCTCGTTCAGGGACATCGATCGCACAAGTGTTGGCGTGTCGGTCTCGGGGTAGTAGATCTCTTTGTCCCATTGGATGA
ACTGTGCCTGCAAATATTTTACCATGCTCATGGAGACCGAGAGTGAAATGGGCACAAACTGGTACATCAGAAGGAGGTAGTAGAAGAGCATCGTGATCCA
GTCCACAACACCGCTACTGTTGGACTCTTCGAGTCTTAGATACCATGGCTTGCCAGTGTTTGATTTCCACACGACGgAGCCTGTTGCACCGGCAGCACTG
AAAATCACCAACAGCACGAGCAGCACGATGATGTATCGGTTGATGGATTGATCCATCGTGCTCATCTTGGAAGGTGGAGCTGAGTTGCTCATCATAATCT
TTGTGTCTTTGCCcGTGTTGAAGACAACACCGTGTACCCAGTCCGTGTTCCTGATGATGCACCCACGCAGGATGACGCTTTCGTACGgAaTCGACTGCTT
GTCGGTACCTTGCATTTCCAACACTCCCTGGAAGCTGTTGATCGCATTGTTTGGATGCTCGCATCGGATTATTCCCTTCATCTTAACCAGACTGTCTGTC
GTTCCCATTGTCTCCATCaTGCGTTCCATCGCCGAACGTACTTTCATGTTCGTTTCTCCATCCAGCGATTTGGTTTCAACATAGCACAGTCCCGACGGTG
GTTGACCCGGAGGCTCGCTCACCGCAAGCACGAGGATGTCGGCCGGCACTAGGTCGCGGTTATTGAGCTTGATCATATCTCCGACGACGACGTCCGCCCA
TGGCTTGGACACGAATGTCTTAGACTCTACATCCAAGACATGGgTGGGGCGTGAGTTGGCGACGCCGTCAGCAATGTGGCGTTtACGgtCTtCCAGCACA
GCAAaaCaCGGCGtCgaCCATGATGaTAAAGagCAATGGCGGCAGCGTGGACGGCTGACCATTGGTGTtGCTGATGGgCGGgATGCATTGAAatATGCAA
ATGAGGAGGAAGTAGAGgTTGGCGAGTTTGCGGAAGGTCTCGAAGAGGAACTTGGGCACGAACGTCACGACGGTGTACTTGGACGTCACGATGAAGTTGT
CGCAGTAGCCCAGTTCCGTGTTCTTGGCCTTGTCGTTGAGATGCACGATgCGGAAGTcGCCCTTGGAcGCCGTCGTAGTCATGATGATGGCAGCGACGGA
CGGCCCCGGCTGGCTCGGCGCGACGCTGGCGAGCTTCGTCCTCGTCTACGAGATGGCGTCACGTGGCTTGCGCGGATGCCGCGGCTGCGGCTCTGACGCG
GGTCATGCGCCGTCACCGGGAGTTTCCACCGCCGTGAATAGCGGCGTCCCAGTCATTTATAGCCGGCGCCATGTCGGCTATtCATGGGCCACGATGTGAC
ATAGGGTTACGCAAGGGGTTACACTGGGGaCTGGCCAGGTGTATCCATCCGCGCGGATCGCAACGTGTGGCCGCGTCCGCATGGGTCCACACAGAGAAAG
tCGGATCATATGAGCGAGGAAACTGGGGCTATAGCGTCATAGCCCACACAACTCGCGATCTTTGTTGGGGCAGAGCGaCcTGTCCCACGtCAACTTCAAC
TTCAAATGAGCTTGCTGTTCGACGCATACGAGCGTCGTATCATTTATCACTGTCACCATTGAGTAATGTATCAGCGACGTACTGGTCCGATAGCGATTGT
CGCGGTTGCCTGCCGCGTTCGAGCGACAGGGCTTCAGTTTGGCCACTACACGCGTCCGCAATaCGTCCACAGTGTGGACGCCCCTgTTCCAGTCGGCGTC
ATTTTCGATTTCCCCTCCTagAGCTCACGTCAGTCGGAAGTCCGAGATGCATGTGGGGATTGTCACTCGGTTCGAAGGCTGTGTaTCGCGATTGCTTGAG
CTGATGGACCAAGTGTCATGCGCAGGAGTCGGATGGTTCACTGGTGGTCAAGCTTGGGGTCTTCGGTGAGATTGTCGGCGTTGCAGAGCGTAAGtaTAaG
AAAAAGCGGGTGCGAGATGAGAGAGTGGAGaTCTCGGAAGAGGATGTGAGAGCTGTCAAGGAACTAGAAGCAACGAAACGTCCAGACGCAAGCCGACTCA
ACGACGAGACgTGGATACGCATGCACGATATGATCGTCACTGCGAAAAGCCTGCGCAAAATGTGAGTCGActAGTCGAGTGTTGTTGAGAGTGATGACAT
GACGCGTATTTCAGCACTCAAATCGTACTTGCGTTTTTCAAAGAGCAAGAAATCGCTCAAACCTCACAGACTGGACTGGGGTATCCTATCTATCCTGTCG
CAGTCCCTGTcACCGAAGTTTACGCGATGATTGGTCAGTGAGCGGCCGATTTCGATCAAGTGAGCTGCACTTTTCTGATGGGATACGTATCATTTCCGCA
GCGCCACGAAAGCGTCGAGCATATGACGTGTtGCACGTTCTTGAAGGTATTTACTCGCAAGATACTGTTTCTATCTCATTTCACTGTCAGCGCCTCCAAT
CAATCAGGTATTGGAGTGTTGAAGCGAGTAaGTGGAGATGAAACGAAGACCGCCCGCACCCGCTCGGGCCACTTTTTGTACTGTGGCATTGCTGGTGCGA
TGAAGGGACTTGAAAGCATCCAGCTACGAACTCACACTTTATGCGTCGAAGCGATTGCAAGCAACCCAACGGTGACCAGGCAACAACTTGAtACaGTGTT
GATGCTATCGTGCAATGTCCAGTCTCAAATGGAAGGATGGCCACACTTGGCGACAGCCACAGTTGCTTTCTTGAGTCTCTTGATGGCAAGCAACAGTCCT
GTCGATAACTCACTGTGTGCCGTGAGTACCCGTGTTGTTGAGGCTCGTACTGGTGCTGAGAATGGGCTTGGcGAGGGGATCAcCCATGCTGAAGTGAATC
GGCGGTTGTACGACGTCGTAGCTGTGCTCGCGACGGTGAACGTGATAACATTACCAACCCTTACTCAATCACTCAAGAGGAAGTGCAGGAAGGTCAAGGG
ACGTGCTACACCACGCAAGGGTGTGCTGTTTCACTCGGCCATTTTCCACAATCCAGCTCTACTGAAGATTGGAGACTCAGACTCTAAACGTCTTTTGCTG
AAGTTTAAGAATGAGTCTGATacGGTCGACCGAAGCAGTCTGGAGGAAGCCATACCTACAGACGTGGAAAAGATCGACCGTCGaGTTAACGAACCTCTAT
GTcATGTACTAGACAACGGGTGGTTCTCCCTCGATGATCTCTTCCCGGGATTAACCATGATTGAAgAcGTAGACTCCCAGATGGTCGAGTGGTGGAGCCT
GCCTCTACGCGAgCTTctACTCCGTGATGCACTAGACAGCGTCGACTTCCTCGACTGGGAGATAATGCAGGCGACGTCTCGTGCACAGAAGCGCATAAAA
ACATGTACTCCAGCAGTCGCGCTACTCGAACATGAAGAGCATGTGGATTTAACATGCCACGAAACGCTGCTTGgTGCATAGGGATGTGAAGAGATCAGAC
GAACCAATTAGAGATCCTAGAGTGAAAGATGCATTGCCCATTTCATATCCACACGTGGTTATCTTTCTCTTCGTCTAGCGTCGCGtAGTtCATCCCACTT
GCCACTCCTGAACAACTCAGGAACCCACTCGCGTCGCTGAGTCCATCGTCgAaGTCCTCTTCCTGCTCCTCCCCGCCTTCTTCCACGTtCCTGGCTCCTT
CCTCTGTCTCCTCCATTTGCAGCTCTTCTAGACGCTGCTTCACTTCTTCCTCTGCATCCTTcaTCTTGGTCAACAGTTCCGGCGCCTCAACTCTGTAGAA
TTCATGAGCCACGTCAGCACaCAGCTCCAGCTCGAGCCATTCCAAGCACCATCTCGTACCGATTCCTCGCGAGAGACACTCGGATCTGCGTTGTGATGCT
CAGTGGCACGACATTTGtCGCCAAATTGAGCGTCTCCAAATACACGTTCACCTCCAATGCGTTGAGCAGCGCCTGCGCTCCTGGAGCCGCGATGCGGTTG
TGCACTAAGCCGAGATACTTGAGAGTGCGGTTGCATCGGAGAGCACTCGCAAACGCTGTGGCCCCTACGTCTGTGATGGCATTGCTCCATAAGGACAAAT
GCTGCAACGACTCGTGTCCGTAGAGGGCGCTGGCCAGTGCATTCGCACCGACGTCGGTGATAtCGTTGCTGCACAAGTCGATGTACTCGAGCGTCGaGTT
AAAGCGCAGCATGTTGGCGATGGCTACGGCACCACGATCGCCAATCGCGTGGTCGCG