Description :
From Genome Similarity Track
Location :
Scaffold_1047:2158- 3221
Sequence
1063 bases(100 bases per row)
GATGTTCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTT
TGATACAAGTCTACTGTAAAATATACTGATATAAAACATAAGCCTGTCATAGCAAAAACAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAA
CCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCTGTCCGTCATT
CCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTTCGTTGGCTATAAATAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCC
CTCTCATTGGCTGTATAGTGGAAACTCTGCGCGATTGGCTATTATAATGCGTAGTGTGGACTACACCACATCGGAATTAGCGGACTGAAATCACTGATGC
TGATTGGACAAAATAAACCGCCTTTAACAACGCTTCTTTCCACGAGTTCCCACGCCTGGCGCTTCAGTCCGTTCTGCAAACATCCCCTACAAGTAACAGA
GTAACCTGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAA
GGCGGCCTCCCCATTCGCCAATATTATAATGCGAGGCCTCTTATTGGCTATATAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTA
CACCACATCGGAATTAGCGGACTGAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTAACAACGCTTCTTTCCACGAGTTCCCACGCCTGGCGCT
TCAGTCCGTTCTGCAAACATCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAA
ATCCGGACTTTTCGTTGGCTATAAATAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTA