Description :
From Genome Similarity Track
Location :
Scaffold_108:215777- 217694
Transcript NameFunction/comments
Physo_142130hypothetical protein
Physo_142131hypothetical protein
Physo_122564hypothetical protein
Physo_142132hypothetical protein

Sequence
1917 bases(100 bases per row)
TTCTGGGGCGACGGACTCGTGAGCGTCGGCGCCGGCAGCGCGTCGTCCGCCGTGAGCTCCACGACGGTGTTCTCCCCAATGACCTGCAGCGGTCCCGCGC
CTGCTGCCGAGCGCGTGCTGGCGCTGCCGTTGACGGCGCTGCGGCGACGAGGGCGACGCAGCGTGCGCCCAATTTGTCGCGAGCCCATGGTTGGAGTGTT
CGGAAGTTTGAAAAAGTGCGCGCAGGCCTGTAATTGGGCGATTTGAATTACACTTGATCTCACTATGTAGGGACCACTATTTACGCCAGGTTGCCCTTGC
GACTTTCCTTGTCATGGTGACTCTCGAATGGTTACTGCACTTCGCTCGACTTGAATGTGCCTAGCATCCGAGCTAGCTAACAAGTGCTATAACTGCTACA
GTAGTATGATATTGGCTTGACCTTGACAGGCCTCTGACAACGCGAAGGAAGCGAGCGCAACGTGATGCTTGGTACTAGCAGCAGATAACAACGGCCAACA
TTCAACAATCCCGTATACACTTCAGCAACATTCTATTCAATCGAGATGCATTACCTTGCTTCTTGGCAGACAATCTCACCAGTTGTATCGGAGTCTCCAA
GTCGGAGCCTTCGCGCCCCGTGCCGTGCGAAACGATACACTACACCTTCATTTACATCGTCGTCCTCCATCCTGTGCTGTATTTACTGACCTGCCGGCGG
TGCCGTGCCCTTGACCCACTTGGCCACCTTGCTGAAGATCACGCCCACCACAATGCCGATGACAAAGATTAGCCCCATGGAGCTCATGTACTCGAACGCC
GTGACCATGCCCTGCTCCGTCTCCGTCTGCTCCTCCGTGTACCAGCCAGCCGTAAGCATCTTCCTCTTGGTCCAGACCTTGTGCGCCAGGTACGACGCCA
CACCCACGGTCAGCACTCGCACCATGAACGGCCGCTCCTCGACTTCCTCTGCAGCAGCAGCAGCGGCAGGAGCAGCGGCAGCCGCTGCTGCATTCTTCTT
GCCCTTGGTCTTTGTGCGGCGCTTCGGCTCCGTCTTCCACTTGGCCGACGCCTTCTCCTTGTTCTCCGCTGCCTCGTTCGCCATCGTCGTCGCTAGAGTC
GAAATGGAGGTCACGACGCGGTATCATTGACGGTGTGTTGTACACGAAGTGCAGCTAAAGAGTACCCCTGGTTACGCTGGGTTACGCCGCTGGCAAAGTG
CGGCTGAAAGTCACTCGTGGACCCGAAGGACAAGCAGCAGGAGCCACTCGACAGCAATGAAGGTCCGCTCGTCCGTGAAGCGCATGTGCGACGGCTGCAA
GGTCGTCCGCCGGCGGAGGAAAGTGTACGTGATCTGCGACCGCAGCCCCAAGCACAAGCAGCGCCAGGGCTTCCACACCAGCGCGCTGGCCGCCGCCCCG
CAGGAGGGTGCCGTCGCCTCGCCCAACGCGAGCTTCCAGACCGCGCTCAAGCAGCTGCAGTTTCCGGGCCTCGCCCCCTTCAAGGCCTTCCGCGACGCCG
CCATCGAGATCCCCAAGCTCTGCTAGACGGTGGCAGTCATTCGGACGACGAGGCAGTCAGGTCACTCAGGTCGGCAATGGCTCGGATAGCGCTGCAACGC
GCTCGGCTTAGACATAACTCAAGATAATCACATTGCGCTGTGTCAGTTTACGTGTATGCTTGCCGCGCTGCCTGCATCATTGCAATCGTGTGAGCACGCA
CACCGCCTTGGAGCTTGGAGCTGCTCCCGCAACGTTACCGGGACTAAAACTGAAATTTTACGGTAAAAGCCAGTGGTTCAGTCACGTTACCGCACGAACA
GTTGAAGATTTCCTCCTTTTAACGTCATGCCACGCACTCGACCGCTGCTGGCGCTGACGCTGCTCGCGTGGGGCCTCGTGTGCGACGCCGCGGCCGCCCG
GACGCACGCGCGGTTCT