Description :
From Genome Similarity Track
Location :
Scaffold_52:21576- 23834
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_52-snap-gene-0.8Sorting nexin-22

Sequence
2258 bases(100 bases per row)
ACCCGTTCAAGCTGCTGCTGCCCGTTTACAGTGTCCCGGAAATTCCTGAGACGGTCAACTGTGTGTTCGACGATGCGGCCGTGGAAATGCAAAAAAACAT
TATGAAGACTGTCAAGAAGATGTTTGGCAAGGACCGTTCCAAGCTCGAAGACTTCAAGATTAACTCGCGTCTCTATGGGAACAACTTTATGGATCCAGCT
GAGTACCTGGATTCGCTCGTCAAGGATCTCGGTGGCAACCGTGCGCTTCTGCTGGTACCGTGTCTCGTGTCCATCCAGCCCGACTTTATGAAACGCAGTT
CAATGCTTGTCGCCGCGCACAGCTATCGGCTACGGAACCTCGCAAGACTGGAAGCAACGCTGGACAAAGTGCAGGAGTCAACCGCCGTGAGTGCGGCGGC
TCCTGTGCCCACTGCCGTCGCAATGGAAGAAGTTAAAGTCACTGTGAGCGTGTCGGTTGTGAAAGATGCGAAGGCAGAGCAAGCCACACTTGCGCCAGTT
TCACTTGTCCAAGAAACGATCCCGAAGCCTGTCGTTGCTGAAGTCACCATTTCTCAACCACCCTCAGCTGTGCTCGTTGCCGCTAAGCCTGCCAAACACG
CGGTCTCCGAGCCACTGTTGTTTGCTGCTCCTGAGCCGCAACTCTTCGAAGCTGTGCTCGTGGAACCGACGGCTCCAACTGAAGCTGTCCTAGCACAAAC
GCTCATTCTCGAATCGTCTCCAGCTAGCGTGTCCGTACCCACCGAAACGGCGCCAACAGTTGCGTCGCCGAGTAAGATCGAAGACGATAAGAAGCTCGAC
CCTACCGCAAGCTTTATCACGGTCGACACGAACGTGTCGAGCGAACGGTCGTCGCTGTCCAGCCCAACGGAAACCACCGCTGAAGTCACTACGGTGGTGT
CGCCGCGTCCTCAGCCCGTGAGACGGAAATCTACGCTCACGCTCTTTGGCGAAGAAATTATTGGCGACGATACGGACGATGAGATCAAGATCACTACAAC
CGACACCACGACCAAGCCAAGCATTCCGACCACGACCAAGGCAAGCAGTACGACGCCCAGTCCGAAGCCTTCGCTTTTTGAGGCCGAGTCGCTGTTTGGA
GAGGTCATTCCTGTCTCCGTCAAGCGAGTGGCCGAGCCGCCAGCCGCCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTAAAGTC
TCCACCACGCACGGGGATGCTCTTTGGTTTTGCTTCGGCGGGAGGTGGCGACTCGGATTCAGACTCGGACTCCGAGTTCAGCGACTGACGGAGAAGTGTA
GCCATGTTCAAAATTGTCATTTTCAGAAAATCTCGATTGATGTCTTGTAATTTTCAATTGAGAACTATATTTCAACGGAGGTTTATTATCAAGCAGGAGA
GGATCACTGAGTCGTGGTTGATCAGTCTCTTTTTTTCGGCATCACTGCTGATCTGAACCTCGAGAAGATCACCCCACGAGACGAAGCAACATGACGGCGC
ACCACGTCGCGCGCGCCAGCAGCTCGCTCGCCGAGCACGGCACGTTCCGCGTTGAAATGCTCGGCAGCCAAGAGTCGCTGGACCTCGATAGCAGCAAGTT
CTATACGGTACGGCGCCGCCCACGCAGAGAGCTACGCCCTCAAGAAGCCGCTCACGAAATGGTTGTCACGTTTGATACACAGGAATACATCCTCCGCTGC
ACGTGGACAGACAGAACTGCCGAGACCGAGGTACTCAGAGTGCATACAGACAGTGGAATATGCTATGGTTGTGCACTCAGCGGCGACGTGCGATGACGCG
CTTGTAGGTCTGGGATGTCGTGCGGCGGTACCGAGAGTTCAGCGCGATTGATATCCTGGTGCGTCAGCGTGTATCGCTCGTGGAACAAGTCCTTATTGGG
AGCTGACTGTTGAGTGTATGTGCGTGTCATAGCTGCGAGAAAAGTATCCATCGCGAGCGTCATTGTTCCCGTTGCTTCCCAGCAAGAAACTCTTCGGCTC
GTCGCTTTCGGCCGAGTTTGTCGACAAGCGGCAGCGTGACCTCGGCTACTACGTCTCCTCGATCCTGCACAGCTCCCCCATGGTACGTAGCGCTGCCATT
CTGGCGTCTCGAGTCATAATGGCGCAACTAGATCTCACATTGCTGCCGTTCATGTTCCCAGTTGGTGCAGGACGAGATCATCGATTCGTTCTTGGACATC
AAGCGCCACATTCTGCAGCGCGCGAGAGACATGGAACGAAAGCGTGCCATATCTACCC