Description :
From Genome Similarity Track
Location :
contig_56:215728- 219270
Transcript NameFunction/comments
g10255.t1ABG66533.1 reverse transcriptase, partial [Phytophthora sojae

Sequence
3542 bases(100 bases per row)
CCCATTACAATTCCGCCTCCTTCTTCAAAAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTTGTTGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAG
CCACTTGCACAAGTCCTTCTGATTTACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTACCATCCTTGCCAAGGAAACATCCCAAGAAGG
GAATCTCTTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTATCGCGCATGCACATCAATACCTCACGGAGGTGGTTAACGTGCACTTC
GACAGCCGTCTTACCTCCTGAGGCACGACTGTGCACGAAGATATCATCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAGT
CGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGAATCACGAGCCATTCCCACAGCATCCTGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTG
ATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGAGAT
AGGCGTGGACGCCGGGATAGTTGCTGCATTCAACTTGTTGAGCGCATGTACCATACGCCACTTCCCATTGGGTTTACGCACGCAAAACGTCGGAGACGAG
TGCGGCGATTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCATCGATCACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGCG
TGGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACGACGTCCGAGAA
CTCCTTTAAAAGGGGGTAGTACGGATCCGATGGGTCTTTCAAAATGGCCGCGCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCCTCCAACACCTCG
GGGTCCATGACCGAGGAGGTGTTGAGCTCGACCGAATCGAGTTCGCGACGGATCAGGACCATCTCCTCGAGCTCGCCCACCTTCAGGGAGTCGACAAACT
CGACATACGAGAGCTCCTCGAGTTCCAGTAGCTCTGCTACCGTAGGCAGAATAGCTAACCCCCCGCCGTCCTTGTACTCGCCCGTGAGCACGTCCAATAC
CGTTGGTCCGACCACCCTATCCGAGGGGTCTGCAATGCGGCGTACTACGCCTGGACGTAGTCCCGCTGCAGTTGTGCCAGCCTCAGCGTCTTCCGACGTG
GTAGTCTCTGCTTGACCACACGTCGTGCGCGAGCCCCAGCTCCAACGTCTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCC
CGCTCGACCACTCTCAGTTGCGCGAGCACCAGCTCTAGCGACTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGTATGCCACCCGCCCCGTGGACA
AAGGCGACGTTTCGTTCTTGAGAGTTTCATGAGCCTCATCCTGAGGAGCACACAAAAAATCCCATATCTTCTCCCACATCCACCGAGGCTCATGAGCTCT
CGAAGATGTAGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTGCAGTTCGCCGCGTGGCACACGATGTTCATGC
ACAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGCTTGTGACTAGCACCAATGGTGCGACTTCGCCAATCAATCCA
CGGCTCATGTTTAGCAAGCCAAGGATGCCGAGGATAAGATCGTACCGATCGTCCATGTCGAGGACAATGAACGGTCCGACCGAGTTGAAATCGTCAAATT
TGACGTTTAGGGATAGAAGGACCTTCCGTGTAGACACGATGAATTCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACT
AGCATACAATGCATTGTTCCTAGCCACACTGGCCTTCGTGGCGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTA
ACGCTGGCTGTGACAACCACGAGGTTGGACCGCGCGGCGGCCACGGAGAGACACAAAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCA
GAGCAACCGACCTCGAGGAGGAGCGATGTCTCCCAGCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGT
GACGGAGCGGCCTTGCCGCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGC
GTTGATTGCGCTGGGGACGAGCCGACTCGGCCGACGAGATCTCCATAGGACTGGGATCTTCCGTCGCCTCTGCGCGACCCGCGTAACCCTGCGCCGAGCG
CACGCAATGATCTTCCACATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGACCCGAACGGACGCCAT
CCATGAAGGCCGTCACCTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCCTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGTGTGCGCTT
TCCTTGCTTGCACCGCAAAAGAGTGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGA
AATACCCCGGAGACGAAGTCTCTCGTGCCATCGCCCATGCGTGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACTCGTAGAT
CTGCCCAGCGCTCAGTGCTATCTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTACCGTCGAACGTCGGTACCGACATCCTGACGGGCTTC
GTAGTTCCTTGCCGTGCGGCGTATGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGTGCGAGCAGCTTCCTGTG
ATGCAGTACTCACGTGAGCAATCAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGAAGGTTGGGGAATCCAGCAAA
CGCTGCTTCGCCCAGGAGACTAACCATCTTTTCCAGTGTAGCCCAGTGGGCATCTGAAAGATGAGGAAAGTCCTGCCGGGACGGCAGCCTGCTCTCTGAG
TCTTCCATACCCAGAGAGATCTTGATTGTAGCGATCCGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCACCTTAGC
CTTAGAGGAAGCGTTAACGCGCTAACCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGGGTACCAAACGACTT
GCGAACTTCCAGGTTAGAGTTAAACTGTCTGTATTAATCTCA