Description :
From Genome Similarity Track
Location :
Scaffold_285:21572- 22593
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.20Telomerase reverse transcriptase

Sequence
1021 bases(100 bases per row)
AAGCACCGCTCGATATCCACGGACACGCAGTATAACGCAGGCGGTGCTTGATCTCCTTGAAGGCGCTCTTTGCAGCTCTTACATGTTGCCATGCCGCTGA
ACAGTGGTTTGATTCGCTGATAGATCTCGTCCATGCTGCGCACAGTTGAACCAAGAAGCTGCTTTGCTTGACGATCTGCTTCGAATAATAACACACGGTG
CAGAGGCTCAAGCGCCTTGTTGACCGATCTCTGGTTACGGTCGACTGGAGACGAGAGATTCATCAGCGGGCGGATGCCACTCACTTTCGGAAGCAAACGA
AGTCGTGAGGTCGCTAGTTGCCGGGGCTGCTCTAGTACAGTGACATTGTTGACGGGCTGCAGAACTCCAGCGCTTAGGTCGTGCACTGCCACATTGCTGC
GGATTATAAAAGTGAGCAGTCAGTGATCATATTTTCGAAATAGAGTAGCATCGAAAAATGCGCGTAGCAATACGAACCTGATGACATCCCAGACTTCACG
CTGGTAGTAGACGATCTCATTCGACGCTCCTTCGCGCTCCGTGATGTAGAAGAGGTTCCGCAGGAATGGGAACGCCAAGCTCTTCAACAGCCAAGTAATG
ATCGTTTGGAAGAGTTCCTGGCGCTTGAGCAGTTCGTTCGGAGGGCTTTAGATACAGAAACGGCACATTAATCTCATGCGGCACAAATTCGTTGATTACA
GTCAGTGATAATGTGTGCACGAACCAATTCGATGGATTTCCCTGGGTATTCATCCACTCCACACCTTTCACTTGCATCTCGTTACAACACTATTCACAAT
AAATCATTGTTAGCATTGGCATCATCTCTACAGATGACAAAGCCCTTTTAGGAGGAAGAACAGCGTACCTCTTTCAGCGACATGACGTCATACTTTCGCG
AATTCACAAACCGCTGTAGAAGGCTCTTGACGCACACCCAGTTCTTCGTTGTACTCTGCCCCCAGATCTCTTTGGGGATAACTTGCGCGACAAACTTCCG
AAGCAGTCGAAAAACCACTTT