Description :
From Genome Similarity Track
Location :
contig_56:215700- 219233
Transcript NameFunction/comments
g10711.t1hypothetical protein

Sequence
3533 bases(100 bases per row)
CCCATTACAATTCCGCCTCCTTCTTCAAAAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTTGTTGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAG
CCACTTGCACAAGTCCTTCTGATTTACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTACCATCCTTGCCAAGGAAACATCCCAAGAAGG
GAATCTCTTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTATCGCGCATGCACATCAATACCTCACGGAGGTGGTTAACGTGCACTTC
GACAGCCGTCTTACCTCCTGAGGCACGACTGTGCACGAAGATATCATCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAGT
CGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGCATCCTGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTG
ATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGAGAT
AGGCGTGGATGCCGGGATGGTTGCTGCATTCAACTTGTTGACGCATGTACCATACGCCACTTCCCATTGGGTTTACGCACGCAAAATGTCGGAGACGAGT
GCGGCGATTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCGTCGATCACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGTGT
GGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACGACGTCCGAGAAC
TCCTTTAAAAGGGGGTAGTACGGATCCGATGGGTCTTTCAAAATGGCCGCGCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCCTCCAACACCTCGG
GGTCCATGACCGAGGAGGTGTTGAGCTCGACCGAATCGAGTTCGCGACGGATCAGGACCATCTCCTCGAGCTCGCCCACCTTCAGGGAGTCGACAAACTC
GACATACGAGAGCTCCTCGAGTTCCAGTAGCTCTGCTACCGTAGGCAGAATAGCTAACCCCCCGCCGTCCTTGTACTCGCCCGTGAGCACGTCCAATACC
GTTGGTCCGACCACCCTATCCGAGGGGTCTCCAATGCGGCGTACTACGCCTGGACGTAGTCCCGCTGCAGTTGTGCCAGCCTCAGCGTCTTCCGACGTGG
TAGTCTCTGCTTGACCACACGTCGTGCGCGAGCCCCAGCTCCAACGTCTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCC
GCTCGACCACTCTCAGTTGCGCGAGCACCAGCTCTAGCGACTTCTCCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGTATGCCGCCCGCCCCGTGGGCAA
AGGCGACGTTTCGTTCTTGAGAGTTTCATGAGCCTCATCCTGAGGAGCACACAAAAAATCCCATATCTTCTCCCACATCCACCGAGGCTCATGAGCTCTC
GAAGATGTAGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTGCAGTTCGCCGTGTGGCACACGATGTTCATGCA
CAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGCTTGTGACTAGCACCAATGGTGCGACTTCGCCAATCAATCCAC
GGCTCATGTTTAGCAAGCCAAGGATGCCGAGGATAAGATCGTACCGATCGTCCATGTCGAGGACAATGAACGGTCCGACCGAGTTGAAATCGTCAAATTT
GACGTTTAGGGATAGAAGGACCTTCCGTGTAGACACGATGAATCCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTA
GCATACAATGCATTGTTCCTAGCCACACTGGCCTTCGTGGCGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTAA
CGCTGGCTGTGACAACCACGAGGTTGGACCGCGCGGCGGCCACGGAGAGACACAAAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCAG
AGCAACCGACCTCGAGGAGGAGCGATGTCTCCCAGCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGTG
ACGGAGCGGCCATACCGCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGCG
TTGATTGCGCTGGGGACGAGCCGACTCGGCCGACGAGATCTGCATAGGACTGGGATCTTCCGTCGCCTCTGCGCGACCCGCGTAACCCTGCGCCGAGCGC
ACGCAATGATCTTCCACATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGACCCGAACGGACGCCATC
CATGAAGGCCGTCACCTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCCTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGTGTGCGCTTT
CCTTGCTTGCACCGCAAAAGAGTGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAA
ATACCCCGGAGACGAAGTCTCTCGTGCCATCGCCCATGCGTGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACCTGCCCAGC
GCTCAGTGCTATCTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTACCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCCT
TGCCGTGCGGCGTATGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGTGCGAGCAGCTTCCTGTGATGCAGTAC
TCACGTGAGCAATCAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGAAGGTTGGGGAATCCAGCAAACGCTGCTTC
GCCCAGGAGACTAACCATCTTTTCCAGTGTAGCCCAGTGGGCATCTGAAAGATGAGGAAAGTCCTGCCGGGACGGCAGCCTGCTCTCTGAGTCTTCCATA
CCCAGAGAGATCTTGATTGTAGCGATCCGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCACCTTAGCCTTAGAGGA
AGCGTTAACGCGCTAACCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGGGTACCAAACGACTTGCGAACTTC
CAGGTTAGAGTTAAACTGTCTGTATTAATCTCA