Description :
From Genome Similarity Track
Location :
contig_199:21561- 23179
Transcript NameFunction/comments
g12052.t1Astacin, peptidase M12A family, neutral zinc metallopeptidase, Zn-binding site

Sequence
1618 bases(100 bases per row)
AACTCGAACACGACTACAGTGGGTAGCGCTCTCACGGCTACCCGGACACGATGAAAGCGCTAGTGCTGCTCAGCTGTAAGAGATCTCTTCGAAAGTGCAG
ACGACTTCTTGTTCTGGATCTGGATGGTGTTCTCGAGGTTTTCCCACCACTCCAGCATTTCAGCGACTGAGCCATCAGCGCTGCTACCTTCGCCATGAAC
ACCTCCAGGCTTGTAGTCTGAGTCTGACGTTTTGGAGGCTGAAGTCCTTGCTTGGCTGACGATCGCACTTCAGTCGAAGGGTTACTAGTTGACGGCTTCG
ACGTGTGCTTGATCATGTCCGAGATGGAGTCTGGGGCGCCTACACTTCCAGCAGTCGATGAGCCACAGTTGGGATCTTCACATCACGCACCGTCGCGTTA
TCTTTCGAGCCATAGAGCATGCGCAGCGTGTAAATATCCCCAGCACTCAGCACCGCGCGTGTGCCAATCTCCACGTCGCGACTCGAGTTGCAGTGCTGCT
CCACAGGTTGGATGCAATTTTTCACCATTCACGTCGCAAAACGCTTTGAGCGGGTACTGAGCCTTGGGGAAGCAAAGACCTGCCGTGCGGCCGTAGTGCA
TGATGGACTTGGGGTCGTACGCCTTGAGTGTCGCTTCTCGACTCGTCGTCTTGGCATAATTCTCAGCGGACACTGGCAGGTTCTGGTCGGTGAGCACGAC
CACCTCCCGATCCGGGTGCGTGTGCTCATGGTACAGCCCCATAGCGTGGCCGATTTCGTGCACCACATTGCCCGGGCCGCCGGCGAAGCAGCTCTGGCCG
AGGTTCATCACCTGCGGCTTGCCGTCATTCACGTAGCCCACCATGCCGTAGCACGCGTCCTCGTTCTGCTCAATACTCACGTATTTCCCGTTGCACTTGG
TCACTGGTTCACACTCCTGCAGGGTCACGTTCACGTCCGCTTTGCTGTAGAGATCCACCGCCGTGTTGATGACCTCTAATTCGAAAGCGGAGAAGGACCC
GTTGATGCGGTACCACACGATATTGTCGGGCCATTTGTCCTCCTGCAAGATGATGGCCACGCCCAGTCGGCGGCGCCTAGAGGCCTCCGTGCAGTCCACT
GGGCGACTGTTGATCCACTGCGGGGCGTCCACCAGGCCGCGGTCCTCGAAGCAAGTCGCCGCCCCGTACAGACACCGAGCGTAGACGCTGCCGGGCCGAT
GCGCGCGACCGACTAGATATCTTGCGCTGGCGTGGTCGATCCGGACGCCGTCGACGTCGCAGGCGGCAGGCCGCGCCCACGAACGAGTCGCCGAGAGCAA
CAGCAGCAACGTCGACAGCACCTGCATTGTTGGAGACTTTTGGTGAACTGCTGACTACTTATCCGAGCGTCTGATTGGTTGGAACCTGTCGACTCAGTAT
GGAGTTGTAGAGGTTCATGACAGACAAAAGGATGTAGCCATCACAAACAGTATTTGTAAGTGTCTCGATTGCATGTTGGGCTTCGTATCGTGCATCGGCG
TGCTGCGAATGGTTGTGCTGAACTATATGAGCGAGTACAACCTTCATGTTAAAAGCCACACTCAGGGATAGCTACGTGAGTCAGCAATCTCGCAATCGTA
AGATATGCTTGTGAGTTG