Description :
From Genome Similarity Track
Location :
Scaffold_1229:2156- 3487
Transcript NameFunction/comments
Phymu_g12968hypothetical protein

Sequence
1331 bases(100 bases per row)
TCGTGAGAATTACGCTTTGCTGTCAGCCTACTTTACCTGGGATGCTGTGTACGAAGCAATGCAAACCTACGTAGAGCAGATCCATCTTCGAGAGAGCGAG
CCAGCGCGGTAGACCATGAGGTAGCTGTGACACTGCACTGTCAGCAGATCCGAACCCGGTATGGTCGAACGTGCGTGACGTGTGCGCCATCTATCAAGCC
TAGACGCGAAGTGGACACGCCGCCGATGAAACAGAAGAGATGGGAGTCCAGCCGGCGTCTGCGTGTTTGATGCGGTACGTGTTTCTCGTTGTGGGCAGTG
ATATCATTTTGATGTGAGGTATTAACATAAGTATTATTTTGTTTGACACGGGACATTCAGCAAAgagtacaagaaggacaaaGCACGTATGGTTACAGAG
ACATCTGACGCAGACGTTGCAGTCAtcgtcatgagcttctccCAGAACTTGACGGTGCCTTCAGTGTCATCAACACTGTCGCAGTGGTACTTTACATCTC
TCGTTGTTGTTCAACGTGTTCGGCATATTCTATGAAAACGAGAACATTCAAATGTATTACGTGTACAACGCGACCGTGAGCTGGAAGGGTAGTGACCAGA
TCAACGCAATGCTGCTATACGCTATTGAGGATGGTATTCTTCCGGGCGGCAAAAGAATCTGGTTGTCTACGCAGACAACTGTGGTGGTCAGAATAAGAAT
AATCTCGTCATTAAATTATTTCTAGCTCAAGTCCAGATGGGGGTATTGGAACATGTCGACTATAAAATTTTCGTGAAGGGGCATACGAAGAACTCGTGCG
GCCGGGGCGTTGGCCATACCAGGAAATTTATAGTCaagactgctggacgatTGGGCAAGGAGTGTCGGCCGTAGAAAACTCGGCTTCGTCGGATAAAACT
GTCCACATCTCTAACGACGACGGGTTTTTCAAAGGATACAAGTCCGTAGTGTCCGAGCTCTTCAATAACTCAAGCAGTGTTCAACAGTTTGCAATGGATT
CGCTCAATCCTGGCGTTGTCGAGTATAAAAAGGGTCTAAGCGATCCACCGGATGAGCAGGATCTGCCGTGCAAGGTGGACGGTGTGTTCCCTGAAAGAGC
AAAGTTCATCGAATGTTCACGCATTTCCTGGAGCCTCTGGCCTCGTCCGCTTTGAATGCCAAGATGCGCCGGACAATGCACAATGTGGTGGCCCCTACGT
CCCGGACGAGTTACAGAATGACCCTATCTATGCAGTGCCAATCAGCCAACAAGAATTAACGGAAAATACCACAAAACAGCCACGTCGTGAGCACCGAGCT
GCTACGACTGTGGCCGCCCAGACTAATCAGG