Description :
From Genome Similarity Track
Location :
Scaffold_641:21556- 22626
Sequence
1070 bases(100 bases per row)
TCGAGCACGCAAATGTGAAGCTTAATGGGTTCTGGTCCGAGAGCAAACGGCGCTCAGAGCGCGAAGACGCGACAATACAATACCCGAATTCATTtcaagc
agcgcagcaccacgctcGCTAAGCTTACCGGCGTACATCGCAGCTGATTCAACAACTCTGAGACGACCCCGTCGTAGTCCTTTAAGTGTGATATCTCGAA
GCCTACAACGCGATGCGAgtgtggtggtgatggaggaACCGCTGGACAAAAATAAATTCTACACCACTTCCGAGCTAGAGATGATGGATGAAAGATACAA
CTTTGTGATACCTACACAAGACGAATTGGATCGAATTGAGCAAAACGCGGTCAAGACAATGGAGCCTGTATCAGAGCAGATGGAAGTTTGCTGTGTCTGT
GAATTAAGCTGCGCGTCTCGAGAAATTTGTACGCGAGAAGTGGACAAGTCTTTGATTCAGGTACAATTCTGCATTAACACCTCAACACCACTGCTTTTGT
AACACTAGCCATCCTTTGAATTTACACCGCATCGTAAAGCGGATGGGATGTTGTCTTACACCACCCCAAAATGTGTACATCCCAGCCTTTATTGACGGCT
AGTACGATGCCTCGAAGGTTGATTTGCGTTTGAAAGGACTCATGCTTTATCCGGATGGTACGCTTGGAAGAACGATGTTAACTCTAGAACTTGCTACCAT
TTACTAACTACAATTGGGTTTGTTTGATAGCCATTTACAAAGAGAACGGTATTGCCAAAGCCCAGATTTGTACAACCTGCAGCGATTATCTCTCACAGTG
ATGCCTctcttctccaccaccgctTGCCGTCGCAAATGGAAACTATATCGGCCACTTAAAGCGCGAATTCAGAGCGCTAACACGGACTGATGAACatgct
gtcgctctcgtttTGCCCTCCGTGTCACTATCGGTGGTTATGGGGGGGCTTGCAAAGCCATTAAATCTCACTACTACATCATACGCAATACGGAAGGACT
GATTGTTGAGATGCTGCCGCGGAACCTCTCAAGCAAAGTTCGTGTCACGATGGTTGATAATATGACACCA