Description :
From Genome Similarity Track
Location :
Scaffold_80:215527- 217472
Transcript NameFunction/comments
Physo_109251predicted protein

Sequence
1945 bases(100 bases per row)
ATCTCCTTGAATCCCAACGAATCGGCTCCGTTGAAGCAAAGCAAGACCACAGTCTGGTACAGCGACACCACCAGCTCCTTTTTGCCCGAAGGGAAGGTAG
CCTTTACCACACACTGGGCGAGCGAGTGTTGCCACTGAAGCTGACGGCCTTGATACTTGGACGAGTAGAACTTGTCGAAAATATCCTTCAGCGGTACCAG
TGCATCCGGGAGGTTGATCTCGACAGCCGCGTACGGAGGCCAGAATCCGGTCGTCAACACTTGGACTTGCATGTCAGGGATACCACGGTTTCCGTGCAGG
GCCTCCAACTCGTTTCTGGACGAATCAAAACTGTAAGTTAGTATGTCTTGACGGGAAAACCCAGCACAAATAGTAGGCGTGGATCATACCTGCTAGCAGC
GTGTTGCTGGAATTGAGTCATCACGTTTTGAGAGAGATCGATATCCTTGAACATACCCTCGAGCTGTGACCAAAAGGCAAACATCACTCAGCAATGGCAG
CACACACTCTGGAAATATTCAACACTCACCTTGTTTGTAAACGAGCTACCGCACTCCGTCTTCAGCTTCGACAGCATCAGCTTCTCCAGGTCAAATGATG
CACTCTTGCCCACCAGCAGGCGCTTAGCAAGATCCTTCTTGTAAAACGCCTCGAACACGTCCTTGCCTTGAATGTACCTGAAAATCACCATGACGCGGTC
CAAAAGATTCTCCACCTCCGCCTCGGAGCCGCCCTTGTTGCCAGTTCGCAACTTGGAGTCGACAAACTTTGCCACGAGCTCGGCTGGACGGTTCGCACGG
ACGTTGATCGCATTCTCCATGGCCGACTTCATCGCGAACGAGAAGTCTGTGTTCGACTGGAACGAGTCGCTCAACACTGCGTCCAAGTCCGCCTTGAGCT
TGAGGATCTTCTCTACAAAAGTCTTCTCTTGCTGGTCATCCATCACCAGCTTCGAGACGTTCTTCTGGATGTAGTTGGAAAATGCCGTCTTGAGGTCGTT
AATCGCATCCACCCTGGCGAAAAGTGCGTACATTCGCTTCAGGTCCTCGACCCGGCCTTCCTCCATCAGCGTCTCGAAGCCGCGCTCCAGAAGTGTAGCT
ACGTGGGGCTTCAACAGCTTGCTTTCGACCACTGAAATGAGCTGCTTCTTGGTAGACGAGTCCAGATAGTTGTTCACGCGCTCATTCTCCTCGTGCAGGC
GCTTCTCGACGTGCACCAGGAACTGTGGCACGCTCGCTGACTCGACCGTCGTGGCTCCTTCCTGTAGGTAAAACCGCTCCGAGGCTGTCAGGAACGGTGT
CTCAAAGTCGGCATGGTACAAATGCAGTGACAGCAGCATCCGCAGCAAGTTGTACAGGTAGCTTCGGTTGATCGCCTCGCCCTTGCGCTCGTGCTCGACG
AGCTCCAGCAACGCGTCAATGAGCTTCGTCTCCAAGCTCCGACGTTCCACCAGGTTGTCGCGCACCAATTTCAGCCCCATGTCCCAAATGGACGCGATGT
GGGGCGTCTGCATCACGTACGTGCGGTCCAAGTACAGGAAGATCGTGCGGATCACCAGCATGTCTTCACAGTGGTCCTCCCACAGCTTGTGCACCGCCTC
CAGGAACAAATTCATATCTCCAGCCGAATACTGCAGCAGATCCTCCACTCGGCCACGCACATGCACCGCACACGTCTCCTCCAGCTTCGTATACAGCCTA
AAAACACAATTATCAAAAACTAAGTAAAATATCCACAAAATAATAATAATAATAAAAATGTGTCTTGCAGACCTGGCCGCCATCTTCCACGTGCACATGT
CCTCGACGGAGCGGTAGAGCTCCTCCCTGCTGAGCGCCGACGTCTGCTTGGCGTGTACGGCCTGCACGGCGGCCTGCAGCTTGGCCCACGTGTCCTCCTC
GAAGGCCTCGGGCAGCTTGGGCGTGACCTTGAAGGGCTTGATGGT