Description :
From Genome Similarity Track
Location :
Scaffold_147:2155- 3814
Sequence
1659 bases(100 bases per row)
TCCGAACTGAAGGACTTCAGCGGCAAGGAACATGACGAAGAAGCCGCCCGAGCCTGGTCCAACAAGGTTAGAACGGCTTCCGACGGGATCAGATGCAGCC
AGACGAGATGTGCTTGACATTTGCCGATTTGATGATAGACCCTGCGCGCAATTGGTATTACCAGCTGAGCCGCACCGCTCGCGCGTCGTGGACTGACCTG
GGTGAACAGTTCCAGATCCATTTTTGCGGTGAAGGGATCTCCCTCGTGCGCAAGTACTACCACATGCGGTGCGGGAGTCAGGAAGACCCACTGGATTACT
GATACCGGCTGAATCTGGCCGGGATACGTGCAAACCTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCAACCACTACATCGATACAGT
CCAAGATGACAATCTCGCCGGATCTCTGGTAGTGTTGAGGCTGCCTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGCCATGCGACGCCGCCACCAACGT
CGCAAGATTGAGACCCAAGGTTCGAAATACCGCCAAAAGGCTCCCGCCCCTGCAGCCTCCTCGAGGGCGGTGCGGGTTGTGACTACCGGTCGCGGACGCC
GCGGAGATCACGAAGGTCTCAACGAGTTCGAGGGCGAATCAAGCAGTTCCGATAGCGAATCTGAAGACGAAAGAGCGCACGTGTTTTCGGCAGCTAGGAC
GCCTACACAGGGAGATGGCGAACAGCCAGGGGGGCGCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGCACGGGACTCGATGCTCACACTGCGGATCT
CGCAAGCATACGGATCTCGGGTGCCGGAAGAGGCTCACGTGCCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTCTACGTCTGCAAGTGCT
GTGGAGACGTTCACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTCGCCAATGGTACAACCCGACTCGCCATGCCGGACTGCTGCCCGA
GAGCGTCGAGAAGGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTATACATATGTTCAGAGGA
AGGCGCGAGCGTTAGAAGACCCAACTTCCTGTAATGCGGTAAATACAGCCAGAACTCTTACCTCGGATGAAGATGACTATTCGCGTCGCCCTTGTGCGAT
GGCCCTTCGACTGTCGCCGCGTGAACGTCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTGCGGTCAACAAT
GTCCGTGCCGTCCTACTCTTTGATACTGGAGCCGAAGTGTCGATAATCGACTCTACCTTTGCACGTAAGGTGGGTTGTAAAATTGATACAACCCAGACAG
TGGATTGTGTTGGTGTGGGGGATGCTGTGTACCGCACAGAAGGCCGAGCAGAAGTCAAGCTCACTCTGGCTGGAGAGTTGGTGTACAAGTTCCGTGTGTG
GGTTGGAGATCTCTCAGGACAAGACGTCATTCTCGGCATGGATTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGGAACGCTCTGTCTGCCG
GACGAAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTATAGCAGCGAGGCTGACGC