Description :
From Genome Similarity Track
Location :
Scaffold_1098:2155- 3160
Sequence
1005 bases(100 bases per row)
CAGCGCATCCACATTTGGATCATGCTCATCGAGCAAGTTGTTTCAAAACAACTATGCGTCTATCTAGACGCTTGTGCCTGAACCTTGTTCAGCACAACAC
GAAGCACCTGCTTCCTTCGGGACCATGTCCCTATCATCACGAGATCTCTCCACCTCCTGCTTCCGCTGCGAGCACCGCTCATACGGCTGCGGCCACTGGT
CAGAGCCTGAGCTCGACTACTGATCTAATAGCTCCCCACTCTAGTGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACA
TGATGTGCCCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTCCACT
TCACTAAGTACTGGGTACGACCCTGGCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGG
CCTTGCCTCAGCTGGGCTCTCGCGGGGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACGACGCCGGCGTCCACGACGCGAACGTTCACCGCCC
ATCGGTCGATCTCGAAGAGATGATCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGCTGCTCGG
CTGAACGTTCAGCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACCTGTGGCTCTGCCACATGCTGTTGATCAGCCATCTGTGGATCCACCAC
TTGCTGTCGTTCAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCAGCTGTCCGTGGCCCAGCCACCGTTGGTGCCAACGCCTCCGCGCTCACCTGAGCA
GGGTCTTGGTATGGCTTAAGCAAGCCGACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCCTGGCCACGA
CCTTG