Description :
From Genome Similarity Track
Location :
contig_56:215445- 218979
Transcript NameFunction/comments
g8720.t1hypothetical protein

Sequence
3534 bases(100 bases per row)
CCCATTACAATTCCGCCTCCTTCTTCAAAAGGTTCGTCAGTGGCCGTGCCATCTCAGCGTTGTTGGCGCTGTACTTGTGTAAGTAGTTGGCAAGGCCAAG
CCACTTGCACAAGTCCTTCTGATTTACTGGCACTGGCCATTGTGCGATCGCGCATATCTTCTCAGGGTACCATCCTTGCCAAGGAAACATCCCAAGAAGG
GAATCTCTTCGGCTCCGAAGATACACTTGTTGATGTTCGCATACAAGCGATTATCGCGCATGCACATCAATACCTCACGGAGGTGGTTAACGTGCACTTC
GACAGCCGTCTTACCTCCTGAGGCACGAGTGTGCACGAAGATATCATCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCAGT
CGATTGAACGTGGCTGGTGCGTTCGACAGCCCCTGGGGCATCACGAGCCATTCCCACAGCATCCTGCTGGGTGTGCTCACCGCTGTGAGCGGGACGTCTG
ATTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGTCGAGTGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGAGAT
AGGCGTGGACGCCGGGATAGTTGCTGCATTCAACTTGTTGACGCATGTACCATACGCCACTTCCCATTGGGTTTACGCACGCAAAACGTCGGAGACGAGT
GCGGCGATTTTGACTCGCGCACCATGCCCGCGGCATATTTCGCCGCGAAGAATGCATCGATCACATCGACTTGCTCCTTCGGTAGTGGCCATTGGCGTGT
GGTGCAATATTTGGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGATCTGGAGGTAACACCGACGGTGGGTTATCGCTGACGACGTCCGAGAAC
TCCTTTAAAAGGGGGTAGTACGGATCCGATGGGTCTTTCAAAATGGCCGCGCCATATCGTTTCTGCCGCGAGGAGGTCCTCTCGTCCTCCAACACCTCGG
GGTCCATGACCGAGGAGGTGTTGAGCTCGACCGAATCGAGTTCGCGACGGATCAGGACCATCTCCTCGAGCTCGCCCACCTTCAGGGAGTCGACAAACTC
GACATACGAGAGCTCCTCGAGTTCCAGTAGCTCTGCTACCGTAGGCAGAATAGCTAACCCCCCGCCGTCCTTGTACTCGCCCGTGAGCACGTCCAATACC
GTTGGTCCGACCACCCTATCCGAGGGGTCTGCAATGCGGCGTACTACGCCTGGACGTAGTCCCGCTGCAGTTGTGCCAGCCTCAGCGTCTTCCGACGTGG
TAGTCTCTGCTTGACCACACGTCGTGCGCGAGCCCCAGCTCCAACGTCTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGCGTAGTGGGAGACCCC
GCTCGACCACTCTCAGTTGCGCGAGCACCAGCTCTAGCGACTTCACCTGCGTGAGCTGCCGCAGCTCGAACGCTTTGTATGCCACCCGCCCCGTGGACAA
AGGCGACGTTTCGTTCTTGAGAGTTTCATGAGCCTCATCCTGAGGAGCACACAAAAAATCCCATATCTTCTCCCACATCCACCGAGGCTCATGAGCTCTC
GAAGATGTAGAACTCGCGGTCGGCATAGCCGAAGGCAGTCCAAGTACTTCCGAAGTACCTGCAAAGTGCAGTTCGCCGTGTGGCACACGATGTTCATGCA
CAAACCCGTCTCGGGAAGAGGAGGGGACATGACCCGCCAGGGCTCTGTCCGCGAGGGCTTGTGACTAGCACCAATGGTGCGACTTCGCCAATCAATCCAC
GGCTCATGTTTAGCAAGCCAAGGATGCCGAGGATAAGATCGTACCGATCGTCCATGTCGAGGACAATGAACGGTCCGACCGAGTTGAAATCGTCAAATTT
GACGTTTAGGGATAGAAGGACCTTCCGTGTAGACACGATGAATTCAGTCGCCAGGCGAACAGATACGTTTGTATTTCGCTTAGATGCTTCCAAAGCACTA
GCATACAATGCATTGTTCCTAGCCACACTGGCCTTCGTGGCGAAGTTGTAGGACGCTCCCGAATCAATCAGGACCTTCAACGGCTCGTCATATCCCTTAA
CGCTGGCTGTGACAACCACGAGGTTGGACCGCGCGGCGGCCACGGAGAGACACAAAAGTGTCGTCCCTGGGACTTGCTCCCCAGGAGGTGGAGGTGGCAG
AGCAACCGACCTCGAGGAGGAGCGATGTCTCCCAGCAGGGCGTCCCGCACCTACTGGGAGTCGCCGTTTTCCGAAACCGCAGACTCGATCACATTGAGTG
ACGGAGCGGCCTTGCCGCGGCCCGTCTTCCACGGATTCGTTGGGCAGTTCCGGCGGAAATGACCAAGCTGATTACAGCCAAAGCAGCGACCACTCGCGCG
TTGATTGCGCTGGGGACGAGCCGACTCGGCCGACGAGATCTCCATAGGACTGGGATCTTCCGTCGCCTCTGCGCGACCCGCGTAACCCTGCGCCGAGCGC
ACGCAATGATCTTCCACATGGCGATGTGCACGGCATCGTTGAACGTCGTTGGCTGTCTGCGGAAGAGCTCAGTCCGAACCGGACCCGAACGGACGCCATC
CATGAAGGCCGTCACCTTAACGTCCTCAGAGAGGGGAGCACCTGCCATGGCAGCCTCGAGATTCTGCAGCTCCATGACGTAGTCTTGAAGTGTGCGCTTT
CCTTGCTTGCACCGCAAAAGAGTGACCGGTAACGGTAGGCCACATTGGCCAGGAGGAAAGTCGAACGCAGTTCTTGTTCCATGAACGCCCACGAGGTGAA
ATACCCCGGAGACGAAGTCTCTCGTGCCATCGCCCATGCGTGTGCACGCCCTCCCAGATTGGAAAGCGCGAAGGCAACTTGGGCTCTTGACTCTGCCCAG
CGCTCAGCGCTATCTCGATCTCACGAATCCAGAAGACAAGACTGTCTGCTTCTTTACCGTCGAACGTCGGTACCGACATCCTGACGGGCTTCGTAGTTCC
TTGCCGTGCGGCGTATGAAGCAGGACCCGAGGGGTTCGCCTGCGCCACACTCTGCGCCTCAGCTCGCATCGCCGTGCGAGCAGCTTCCTGTGATGCAGTA
CTCACGTGAGCAATCAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGTGACCTCTGCTGCTCTGCAGGAAGGTTGGGGAATCCAGCAAACGCTGCTT
CGCCCAGGAGACTAACCATCTTTTCCAGTGTAGCCCAGTGGGCATCTGAAAGATGAGGAAAGTCCTGCCGGGACGGCAGCCTGCTCTCTGAGTCTTCCAT
ACCCAGAGAGATCTTGATTGTAGCGATCCGCGCCGGTCGCGGGAGTGACTACAAGTGCTACCAGGTGTGACGGGGGTCACACGCACCTTAGCCTTAGAGG
AAGCGTTAACGCGCTAACCACAACAGACGCCTGGCGTCTCTGTTGTAAGCTTGCCTTCCAGTCGTTTCCGGGTACCGGGTACCAAACGACTTGCGAACTT
CCAGGTTAGAGTTAAACTGTCTGTATTAATCTCA