Description :
From Genome Similarity Track
Location :
Scaffold_54:215389- 217417
Transcript NameFunction/comments
Phyin_T30-4PITG_17382Putative uncharacterized protein

Sequence
2028 bases(100 bases per row)
CGTCAAGGTAGTCGGAACTCCGAGCCATTGATCAAGCCATCTTTGCCAAGCATGTTGCGCTTTATCGCAGCTCCATACTATGTGGTCTATCGTTTCAGTG
GTGCAAGGGCATGTAGGTTTAGGACATTCACGGTGGTCAGGCCATTTATCGTGGCGCAAGTTGAGAGCTCCAAGAGCGATACGATACATTGTCCAGTTTT
GGAAGTCTGTAAAAATACCTTGGGTGGACCACAGCTGGTAAACAGTTTGTTGAAGCGCTGCACTTTGCCAGGCCGATGCACTTTTTTTCCTTTTTATTTT
TTCGAGAGTAGGTTGAAGGCTGTATCGAAGTTGTGTTTTTAATACCTTGGTTCGCTGTTTACGGATCGTGATTCCCAAGTTGGCTGATTTCGTGAGTTCT
GGTGCTGACCAAGGATAGAGAGCGGTCTGCGGTGCTTGTTTAAAAGCGATACCTTCTCGATTTTTCCAAGCCACTAATTCCTCATAGTCGTAAGGTTTTT
GGTACGATGCTGACGCTTTCACAATGCTCCAGGTCCACCCGTCTTGGTTTCGTTGCAGTTGTATGTCCAGATTGCTGCTCTCTCCGCTCTTTACTTTAGC
TGTTATAGTGTCATCAGCTTCCCCATAGGTCCATTCTAAATCATGTTGCATATGTGGGAGATTTCTTGGTTGTAGTGTTTGGGGCTTCACTGTCCAGATT
TTCCAAGGTAGGCTGAGCATGACACATGAGCACCATCTCACTATTTGGCGTGAATGTCTCTGTGTGTATGGCTGTTTATGCAGTGGTGGTTGTAACACGA
CGGCCTTGTCGCTCTGCATTGGACTCAAATTCTCGATAGTAAAGACTATATCTCTGATTCGTCCTGGTCGCAAAGATGGAAAGTTCTGTAAGCGGAGAGG
GTGGCCGTTTTTGTCAGTCACATTTGCATTATCATGCCACGGTGATTCAAGAAGGAAGTTCGCGTTTTCATCTGGAATGTCGCAGTCGTTTGTCATCGCT
GTTATAAATCGTAATTGTGTGCCTGATATCCAGTAACAGGATCGTGTTGCCGGAGCTGATATAATCATTTGTTGTATTTTCTTAAGTTGATCGTTCTTGG
GTATCATTTTGATTGACTGCGAGTTCCATAATTCCAGTTTACCTAGAAGCTGAACAGAAATTTGTGGCTGACCACGGGATTCCTTAGCACATAATGACAA
CATACTTGCTGATGTTGGGCGGAACTGGCAACATAATTGTGATGGTTCTTCGCCTGGGTGGGCCATAGCATGGAATCGCAGAGTGTGGTGACCGGCTACG
GATCAATGTGGTGTGCACCACAGAAGCGTCCCCGGTACGATACCGAGGGTAGGCAAGTATCGGCCGGTGGAACCAGTGCGGCCGAGTGGTGAAAAGCGAT
TCCGCCAGGATTTCAACTGGTACCTACCAGTAAAGCAGGCGATACGAGCGACTGTACGAAATTTCGGTCAGCAGTGAATAAAGTGGAACGCGTGGACGGA
AACCCGGTTGAGATGTACACTACCTGCGTCCGGCGAAGACGTTGAAAGTAGGGGCCAAGTATGGTGGCGGGAAAACGCTACGGCGGCGGCTAATCCGGCG
TTTGCGACGAGACCGGCACCACTCCAGAATATAGAGCGGTACCATGCGCGACAGACTCGAACGCAGCGTGCACCGTTCGTGCCTCGCCCAGGGACGAAGT
GCTTCTTTTACGGTCGAGAGGGGTATTTTGCGCGTGCTTGTCGGTTGAAGCAGGCGGGTCTGTCGGCTGGACATCTCAGTGCAGGGCAAGACGAGAGCGA
AGGACCGGGAGCAGGAAACGCTATGCGGGCGTAAGGGCCCTGGCCTTACTTCTCGCAAGGCCTGGCTTAAGAAGAAGACAGGACGGTTCAAGGCGGCACA
CGCAGCCTGTGAGAAGCCGATGGAGAGCACCCGCGTGCAGAGGCGGCGTGTGGTGGTGTGTGAGGACTACAGCAGATCTCCATGTTTCTCAGGATGTTTC
AGTACGGGTGAGAGCTCGCGTTTAGCGA