Description :
From Genome Similarity Track
Location :
Scaffold_1:21536- 23231
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000573Similar to ALA3: Phospholipid-transporting ATPase 3 (Arabidopsis thaliana)

Sequence
1695 bases(100 bases per row)
ATTGACGATGACTTGCTGGATCGAGTTGTCCAAGAGCGAACACGCGTAGGCAATGTTGATGGCCGTCTCCTCCTTGTCGCCTGTGAGCATCCACACCTTG
ATGCCAGCGGCCGTGAGGTGCGCGAGGCACTTTGGAACGCCATCCTGGAGCTTGTCTTCGATCGCTGTCGCGCCAATCAGCTCCAGATTTTCTTCGATCT
CCTCCATGAGCGAGTCAATCGCGTTCGGCTTGCCGTCTTTTCGCCGGTCGAGCTCGGCAACGTTGCCCTGTGCTTCGTCAAACTTGATCTTCCACTTCTG
AAACCATTTCTCGTCCAGTTTCTTCACCGCGAGTGCCAGTGTGCGCAGGCCGTCGTCAGCGTACTTCTCCATGTGATCTCGTGTGACTTTCTTGAGCTGG
TCCATTGCCGGGTCGTCCTTCAGTCGCTGATAGATCATCATGTCGGCACCCTTTGAGTACAGATACAACTCGCCATTGGGCCGCCGAACGACCACCGACA
TGCGCTTGCGTGTACTGTTGAACTCGAGCACATCGAGGATATCGAACACCTGGCGCTCGCCAAATATCTCGATCGTGGCTTTGCCCACGCCTCGATTCAC
GAAATTGAAGCCCACGAACGACGCACCAGCCACCAGAGCCTGCTCATCGGGCGACGACGCCGACAAACGTACTTCGCCCGTCTCCAATTTCTCCGGAATC
ACTGTGTGGCACACGGCCAAGTGCTCAAAGAACTGGTGGATGTTGTCGCGCTGGGCCGCACCAGTGCCTCCATTCATCGCCTTGAAGAACGACGGGTCCA
CAAAGTTGACGTACTGCATCTTCTTCATGCCCGCGTCCATTTTTGGCTCCGGCGGGATCGGTTTGTTGGCGCGCACGAGCGCCGCGCGACCGATCTCCGT
CATGCCTGAGCCGTACGAGATGCCGTTGATCGAGCACTTGCGGAACTCCATGATGTTGCAAGTGAGCGTGCCGGTCTTGTCACTGAACACGTACGAGATC
TGGCCGAGCTCCTCGTTCAGCGCCATCGTGCGCACGATCGCAGGCGTGTCGGTCTCGGCGTGGTACATTTCGAGGTCCCAGACCATGAACTTGGCCTGGA
GGAACTTGACGCTCGTCATGGACACGTACAGCGAGATCGGGATCACCTGGTAGAGCAGCAGAAAGTAGTAAAACATCATCTGAATGAACGATTCCCAGCG
CGGTTGCGCGCGCACGTCGTCGCTGAGCTTGATGTACCAGGTATTCCGCACGATGTCGTACTGCCAGGTGACGTAGCAGGTGGCGGCGACGGCGCAGGCC
ACAAAGAGCCCCAAGCACAGGATGGCGATCATCTTGTTCATCGAGAGCATGACGTCACTCCACTTGGACGGCGCGGCGCTCGCGCTCTGCATGATCTTGG
TGTCTGGCCCGGTGTTGAGCACGAGGCCAAAGACCCAGTCTGTGTTGCGCAGGTTGCAGCCGCGCAGCAGCACGTTCTTGACCGACAGCGGCATGACCTC
CATGCCGCAGCCCTCGCTCACCGTCACCTCGACCTTACCGGCAAACTTGTTGATATACGGGTTGGGCGTCTCGAACTTGACGATGCCGCGCAGCAGCACG
AGCTCCTGCGGGTTCACGAGCGCATTCATGGTCGGCTGGATGGCCTGGCGCAGCTTCAGGTTCGTCTCGCCGTCCAGACTCTTGGTCTCGACGTA