Description :
From Genome Similarity Track
Location :
Scaffold_36:21532- 26013
Transcript NameFunction/comments
Phyta_totarag1749conserved hypothetical protein
Phyta_totarag1750hypothetical protein PHYSODRAFT_353701

Sequence
4481 bases(100 bases per row)
cttcacccACTTAAGCATCTCTTCGCGGTTCTTCGCAACCATCCGCGTCTGCTGTGTGGGCGAGCAGACCATGAACTCGTTCGGCTTGCCCACTTCTTTG
CCGTGCAGGATCTCCAGAGACTTGTGCATCAGTGGGATCGCACCACGCGGCTCGCGATCACCCTCTCGCTTGTAGTATCGAAGATATCCGTCCGGCTCAA
TGCTGCACCACCGCTCGCGAACGCCACGCAGCGACATGTTGCCGAATGTGCTCTTTTCATTGGAGTGAGTTGGGTGCTTGCGTAGGATGCCACTCATTGT
TGGCAATGAGCCATCTCGAGGGACCTGGTTCGAGTTCGAGTCGTAAGACTGCGTCAGTGAGCCGAcagacgcgctgctgctgcttcggtgGCTGAGGTTA
GGATCGTATCGTTCTGAACCTCTTTGCACACTAGCCGAAGGTCTGTTGCCACCATGCGAAGCCCGACTGCCAATCATGGACGCCCTGCTACCACTGATTG
AGGCTCGAATACTGCCACCAAGCGACGCACGAGAGCCGCCAGTGGACCTCCGGGGAACGTCCTGTATCGTCGGCGGGCCGACAACAGAAGGTCTCAGGTA
CGGTTCTTTAGCCTTTACAGACACGTTAAGAGTTCCTTTTGTCAGCACCTGGAACTGATCTTGCACCACCTTCATCTcgtccttcagctgcaatCGCCGC
TTGCCCAGCTCGTTCTTTCGTGCCTCGTCCTTTTCACCTGCTGCCTTCGCGAGCTCAACAACGGTTTCATGCAACTGAGTTTGTAGCTTAGTCAGCTTGT
TCTGTAGCCGCGACGACTCTGACACGCGTTCGTGTGGAGCTTCATCAATATCAACAGTGTCAATCGACGAATCTGCGTGCTGCAAGGCAACCTTCCTGCC
CTgatcgacgtcgaagaaAACCTGCAACTCATTTTCCATTCGCCGCATCTCGTCCAGTGCCGACTTCAAATCATCCTTCAGGTCAGCTCGTCGGAGCGAC
AGATTGTCGGCCTGTTGCTGATCTCCACCGCTTGTTGCATTCGCTATTCCGGACACAGTTTCTCGCAggttcttctgcagcaatgcaatCTTGTTCTCCA
AAAAGATCAGTTGAGGTGGACGTTCGCCACTAATAAAGGCATCCTCGCGCTtgaccgctgctgctgccacatCCATTTGATTCTGAAACTGGTTAATCTC
CGATTCCACGAATTTGGTtcgctcctcctccattttgatctcttcttcgagatgATCATGTTGTGCTTTAATCTTCTGAAGAAGCCGTTCACGTGCGTCC
TCAGCGCGAGTATCAATAGAGCCTCTGTGCACCATAGAGCCCAAAAATGCCGGTGAGAAGAACTTGATGTCGTACTGGCCATTCGGATCCACGTCAAGAT
CTCCGTATTCGTCCAACTCTTTCTGCAGGATATCCAGCGACTCCTCGATTTTGACGCGTGCTGCCTGCAACTCGTCGTTTTCGGCAATAATTTCCGTGAC
GTCCTTCTCAAGCTCAGCTGTTCGCTGGACTAGTTCTGCCGTCCTTAACACCTCTGGTGATTCAATTTCACCAGCCGCTTGCTTGTCCAACTTCTCGATC
ATTTCCTTGAGTGAAGCTTCCTCTTGGATCAAGTTTTCCCGCTCCTTCTCTAGGGATTCTTGACGCTGCTCCTCCCCCTCAACTTGCGTCTCCATGACCT
CGCACTTCTTTTCCATCTCAAGGCGTCTCAGGTGCATGTGATGCTTCGTCGCCGCCCACACTTGCTTGTGAAGTTCGTTTGACACCATGATCTGGAAGTA
CTCCACACGGAGCAAGTTCTGCATCACTCGTACTGCACGAGCCTCCTTGccttcttctgtttcttcgtgTGGAATTTCTTCCTCGACTCGGCCCACAATG
CCTTTCGTGATATCGGCGAACTTGATGCGGACGGGACGCACCATTCGAGCGAGCAGTTCCAGTACCTCTGAGTATGTATACCCGGTGAGTGAAATCCCat
tcatcatcgtcactcGCATGTTCACTGCAAGACGCTTTTCAGGCTTCACACTCCAGTTATAAATCTCTGCAGGACTTGCCATTCCATTTGGCAGCTTGTA
AATCTCTGCAATGTGGACCTGGAGGTCAGTAAACACCGTGCCTGGAATTCCAGCAATTTGCTTCAGGTTTAGTCCAAGTCGACCTGGTCCAAATGTCACC
TCGATCTCATGCACCCACTTGTAAATGACACCAGTTTTCATGGGAGGACGCAACCACTGCGTGTGTCCGTAAGGTGATACATAGTACGTCTTGCCGTCAT
TGGTTTTGCTCTGGCGTGTGGACCAGCCCTTAGGCATGGCCAGGATCTCGCCAGACTCCAACACCTCGACCGATTCGCACGGGAGTTTGTTTCGGATCTT
CTCCAGAACCACCTCTAAGTTCGCATCGAGAGGCGTGGTCTTCTCAGCAGGCTCCGCTACTGCCGTGATGGTTGCGTGTTCACCTTCCTCACTTTTTTCT
CCGTTTTCATCGTGGTCTTCGGATTCTTTCGTGTCTGCTTCCAATGCTACCGAGGTATTAGTACTCTCTGTGCCCGCGTCTGCAGCGGTGACAAGCAGAT
CAGGCATCACAGCTGGTGAGGCACATTCCATTTCCTGAGGAAATTGCAAGGCTCCTTCGGGTGTTGCCACTGCACCGTCGCCAATCAAGTTGTTTATCGC
AACACCACTAGCTGGTGTCTGATTCTCGGCTGCGGGGGCGTCGGCATCAATCGACAATGTAGGCGGCTCCAGTTTATCAGCCTCCATAGGTGTCGactct
tcctcctcatcgGCATTCACAAGCGCAACAGTTTCCGGTGTCACAATGGCCAACGGGTCCTCCAACTTCTCGACATCAGCTTCAGTTTCTACTGGAGTAG
CTGGCTTCTCCGCTGAATCTCCCTCGACTGGAACAACTTCCTTGTCGTCTGTTGCTTCAGCCTCTTCCACAGACTCGCTATCACTAACAGCATCAGGTGT
TGTAGATGCATCTGCAGTTGCATTCCCCTCCACGTCTGCAGCCGGCACATCTTCCAGCTTCTCATCAGCTTCTGCGATCACGTCACTTGGCTCTTCCACT
GCAGTCGGCTCACTCTCCtcagcagttgcagcaatATTATCCTCAGTTGTTTCAGggtcgtcctcctcctctggGGTCGATGGCTGCTCCACGTCCTTGG
CGTCACCTTCAGCCACGTCGTTCtgctcttctgctgcatcttttccctctgcagcttcagctcctgcctcaccgtcgtcttccgcttctgaagatggcgt
cgtcgttTCATTTTCTTCGTTTGCAGCGCTCTCCTtctcttgctgttgctcagTATCCGGAGTATCTCCGGCAGCGATCGATTCTGTGTCTTGCGCCGTG
GCTTCTACGGGCGTCGCGGGCTCGGGCGGCGGCGTGGCCTGCGTCTCGGCCTCTGGCGGCACGTTCTGCTCCATGTGTCGTGCGTGTTGGTGGTCGTCGG
CGCGCGGCGGGCGGCGTCGTGTCTGGGTTCCCGCGTGGCTTGGTGCCGCTTCCTTCCTTGAAAAGCTCAACAACAACCTCCCAGTGGGGGCAAAATCAAG
CTCCGACTAAGTACGAAATACTGTGGACTTGTCGCTACAAAATCCAGATACTCGCGAACAGAgagtcaacttcaactgttGTTTACGTAGTTTGGGTGAT
GCATCGAGCTCTTTTCAATCCGTTCGAGTGCTGCAGGCGTGGACAAATATAAGCGCCGACTAAGGTTGAGCTAGCGGTTGTGCTCATTCGCAAGCAATAA
ACGGGATGTCCCATCCATTGAGGAGGATGCAGCGAAACTGTAGTACCAGCTCGCGTCTAGAAGTTGCCGGAGCATTGCTGCGACTCAGCTCAGCACTCtg
caactacatgtacagtacactTCGAGTCGAGCGAATTTTACATGCGACACAAGGTACACTTGAAGCCAGATGGAATCCTGATTACGGGCGAGTTCAACTC
AAACGCTACCATAGCCGCACGCAGCCTTCACTGCCGCAGTCAGTTTGCTATCCAGACATCGCATTCCCCCAGTGCACACGGATTCGAACCAGCGACGCCG
CATTGAGCcaacgcagcaacaaccaccAAGTTAGACCTGCGGGGCCTCCACCATGCAGAAGCCctcgctgcactcgctgctcttggactgcagctccagt
gcgtGGCTGTTGTCGACGACTTTCTCGGGTGAAACGGCAACAACATGACGTCGGGCAATGCGCGTTTCGCGTATGAACTCGCACAGCGAAATCTGGGCCA
GGTCATCGGCCGAGcatttcttcttcgggtTCTTCAGGACCATGATCTTCGTGTTCAAGCGGCGGTTGGCTTCGGCTGAATAAGGAAGGCACATGACATT
AAATTGCGATCATCGACCAGatcaaagaagaagaaaaaaatgaagACAACGCACTCCGTGATCGCACGCCATAAAACTGGC