Description :
From Genome Similarity Track
Location :
Scaffold_187:21524- 22615
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_187-snap-gene-0.11Glycosyl transferase group 1

Sequence
1091 bases(100 bases per row)
TGGAGAGACAGAAGAAGACGGAGGAGCGCGGAATGAGCCTACAGTTTTGGCGGCAGCAGTTGCAGTGTGGACTTCGTGCCGTTCGTGTCCAGCGCGAGCA
GTGCCTGACGCGCCTCAGCAAGTTCGACCAGGTCTTCCTACATAGTAAGCAGTGCTAAGGTTAGTCACTTGAATACGACAGCGCAAGAGGAGATCAATCG
CAAGCGACGGCGCCGCGCACCTGAATATGGCGCAGCTCATCTCGCGTGGACGCCAGCAGCGTCTTGGCCTGTATCCGTGGCGCGGTCGAGACTGGCGCTT
TACGCTTGCGCTTTGTAGACACTGACTCTGTAGCTGCGCGCTGTGTGCGCTCGGGCGATGCGCTTCCTTGCGTCGTCGTCTCCATCCTGATGAGGATCGC
GAGTGAGTGTACCCCTGTGGGTACCCCAGTGAGCACAATTTGGCGGGAAAAGCCACGATTTCAATTCAATTTTGAATTGTGCTTGTATTGCCTCATTTTA
GGGACATCCGTGACATAGTGCCATCGCATGTCATTTTCATCCATTGCCATAGCTATGCTTCGTCGTCGACCACGGAGCTGGCGGTCTCCAGCTGTGTCAT
GCGCGTACCGCTCCTCATGGGCGCGCCAACTGTCGGTCGCTGCGAGCGTAGACCAAGCACCACCTGACTCTCTCATCGCGTACGGCGAGCGTGTCTTGCG
cTCCCCaGAGCCGGCCGACAAAGTCGCACTTACGATGCAGTGCCACGACCTATGGCTGCGCGGCGCCCTGCCCATCTACACGGgCGAATCATGGCGTAGT
GACCCGCCTCCGCAACCTGAACGCAGCGCCAAACCGGTGCTGCTGCCGCCCAAGCAAATGCCGTCGCCCAAGGACATTGATGCGCCAATTCCGGTCATTA
TGCTGCATGCGCTCGGTCACATCGAGCTCGGCGCGATCGACAACTACTGGGACACGCTCGTGCGCTTTGACCCGGTACAATACAAGTTACCACGTGCCTT
TTATGATGATTTTCTCACGGTTGCAAGCGACGAAGCCCGCCATTTCAAGATGGTGGACGACCGCTTGCGTGAGCTTGGGTCGTATTATGGT