Description :
From Genome Similarity Track
Location :
Scaffold_60:215187- 216384
Transcript NameFunction/comments
Aphas_H257_14847AlNc14C35G3133

Sequence
1197 bases(100 bases per row)
ATCACCTTGACTTCCACGCCGGCTCGCTCCAGGGACTTCATGAGGTCGGCTGTCACCAAGGTAACGTCGGAGCCGGTGTCGAGGAGGGTCGTCGTGACGG
ACACGATGCCTTCTATCTTGGCTTCGCGGCCGAGGGATTGTTTGCGCTGCCTTGAAGCTTGGTCACCTTCTTGTTGCGCACGCTCTCCCACTTGCCCATG
CTCAGATTCGCCACAGGTTGCCTTCTTGCGGTCGTATTTCGCGCTGTCTTGCCCGGGAGCTGGGGCGCGCCGGGGAGGTCCACTGCTGCTGCCACTGCTG
CCTTCCGATCGTCGAGGCTTGGAGGGCACCGATGGCGCTGCGACTGCTGTCGCAGGCGGTGCCGAAGTCTTCTCGTCTTCCACCGCGGCATATATAAGTA
GTAACCAGCGGTATGCACGCGTAGCCAGTCGACGAAACAGTACACGTTGGTCTTCAACGGCTTGTTGAGTTGGAGGACCAGCTGGCGTTGAACAGACTTC
TGGAGGCCAAGCGGTTTGATCGCCTTGACCACGATGTCGATAACTGTATTGCCTTCTTGATTCTGGTCCTACGCTTGGTCGTCGCGCTCCAAGTCTCGCA
TCAGGTTGTCAAGCATCTTGCCAATGCGCGAGGCGGGGTTCAGGATTGTCGTGTCGAACTGGATCGCCGTCTTCAAACGCTTCTTGAGCACTTCCAGGTC
TTGAGGCTCCTCTTCAAACGCCTTGCCAAGCCATACGGCCCACTCTGCCTCCGTGACGCCACGTTAGTCACGGTTGGCCATGTCCCACAACTTGTGGGAC
ATGGCCGTCGTGCGGTTGTACCGTACAACCGCACGATGAATGGAGACCTGCTGCACATAACAGAGACTAACCGCCTTACCGATCATGAGACCATGACCTG
ACCTCTAAAAAGGCTCATAGGTCTTTCTGCAGAGCCACGCAGAACACCCGTGAACCAGCTCAAACCCTCATCAATTCAATTCACGTAATTCTTGTACGAA
TCCACAATATAGTGTAGCACTGAATTTATCCACCCCCCAGCTGATTGCCGAATCATGATGCTGGCTCCTGGCTAGCATCGATTAATGGGCTTGTTAATGT
GTGCTGGGATATACAGTACATGCTATACTCTGACCAGCATTAACATGACTACTTTGGATATACCCCTTGATGTGGTAATAAGAGCAAGTGCAATATC