Description :
From Genome Similarity Track
Location :
scaffold_349:21512- 23215
Transcript NameFunction/comments
Pl_105792conserved hypothetical protein

Sequence
1703 bases(100 bases per row)
GCTCGCTAAACAAGGATACTCCGTTGGACTGTCAAAAAACCTGAAGTTATTCAACGAGTCTACTCAACGCGGCCGGCAGCTACGCAATTTGTGGCTATGG
GTTGACCAAGTTGAGGCTCTTCGCCGAATCCGAGCTTCACGTGTGGAACAATCACGATCTACGACTAATGGGCTCGGGAACAGCGCTGTAAATGCTGCAA
TGGCTGGTCCACTGCGCGGGTGGCCAGTTGATCCAAATACTCTTGTTATCGCTGGTGTGAAGAATTTGTTGACAACTTCTGGGGAACCCTCGGCAACAGG
AAAATCGGGTTCTTCTGGATCAACTGCCACTGTTCAGGAAGATTACAGAGAGGAAGAGCCTGCTGTCGTGTCTGTGGCAAAGACTGATCAAATCCTTGGA
TGTCAGTACTTTGAAGGACCTGGGCGGCGATTGGGTTTGCTAGCATGCAACTGGGACCCCGACAACGGTCAGGGAGCGTCACGTTCGTCGTCAGCAGGTG
TAGGTGGACCAGGACTGGACAGTGCTGCGGGGAGAAACATGCATCGGAGTAGTTCAAGTATATGGAACCCCCAGAAGCAATACGATGATAACGCGCATTT
TGCCAACCGCTCGTGGAATGAAAATGGCAGACACGAGCTACAGAACATCCTGAACCGATGCGAGTTGGAAGGTAACTATGCTCGAGCGGCGGCACTGGCA
GTTTTTCATGGAGACTTGAACGCAGCTGTGGCGCTTCTTCAGAAGGGAGCAACGTGGCTTACTCAAATGCAGCACTTGAATGTTGGGGTCTCGTCGCCGT
ATTCGCCAGACTTGCTGCAGCTCATTGCAATGTCTGTTGCGGGCTACTCATCGTCAGTTGCTACTGCAGGTGGGTTGTCTCTATGGTCAAACATGACTCA
GCAACTTTTGAAGCGGAGTGAGATCATGTCACAAGCTAACCCTCGCTACTTTCACGCGATGCTTTCGTTCTTGTGTGTCGCGAGCTCATCTTCATCATCT
AACTCAACGAACGCTATGCGGACTAGCCAGCAACCCCAACGGCGTGGGAATAGCCGAAGGCAGTGGGGAAGTGTGGATGGACTTGCAGTTTTTGGTGGAG
CTAGACCTGCCAGTGCAGGTGCATATTCGGCAATTCTCAACGATATTACACTACCCTTAAGTGATCGACTTGCTTTCGCTTGTCGGTATCTTCAAGCTGA
TGAGTTGCTCGCGTTTGTCGCTCAACACGAAGAGGAGAGCGAACAGTTCGGACGCCTGGAAGGATTAATTGTGACTGGAATCAACACTGACGGTATTCGT
CTCCTTCAGACGTACTTGGACATGACGGGTGACATTCAGACGCTGGCATTATTAGCTGCGCGACTCCCATCTTCGTATGTGGCGAAATCATCTTGCCTGG
AGAAGTGGATTCAGATTTATAAGGACTTGCTCAACCAGTGGCAGCTCTTTCATGAACGAGCACGGTTCGATGTGGGTCGCTCGCAACTGGAAGATCTTCT
TAACGGCTTCACCAGTTTTTCTCGTGACTTTGACGCAGAAGATTTCCAAGCCGAACTGTCGGCTCCATCAACTCTCTCCGTCCCGCCGCAGTTGTTTGTA
CGATGTAACTTTTGCAATGCGTCTCTGTCTTTGGCTAGTTTGCTTCGACTTGGTGGTTCTCATTCGTCGTGGCTGAATCGTGCCAAGCCAAAGCTTACGT
GCT