Description :
From Genome Similarity Track
Location :
Scaffold_10:215063- 216834
Sequence
1771 bases(100 bases per row)
ACAGATAGATACTACTGTAATAATCAATAATTTTTAAACATACTCATTACAAAAAACAGCTATCCTCCAGAACAATAGTCATAATACCTTTACAAATGCA
TTCTGTGCAAGAATAGGCCAGTTCCTGTGACTCGCGTATGTGTAACTGTTGGCTGATGGCGACTTGACAGAGTGGCCATTCCCACCATCACACGCCCGCG
CCCATCACCATGGAGGAGGGGGGAAGCGGACAGACCTCAGTACGCAGACGCAGCGTCTGTCGCTACACGCAGGCAGCAGTCCAAGAGCACCACTCGTCAA
AGTGTACTATTGAGACCACAGCAGCAGTTCGCTCGATGCCAGGATGACGAAGAAGCTCAAGAGCAGCGCGTGCGTGGTCGTGGTGTTTATCGTAGTGATC
GTCAGCGTCGCGTGGCAGAGTGGGGCTTTGACTACGGCGGTCCCGGTTGAGGCGGCTGGAACCCGAGGGGGAGCGACAAGTAGCGATTCGGGGTCACGTA
ACGCCGCGCTGGGCGTAGAGATCACCGCGAGTAGCACAGCACTGCCCGCGTCGACGGATCCCGGAATCTCACAAGTGCGAGACATCGGTGCTGACGCTCG
TAGTGCTGGCAGTAGGGAAAGCAGCAACGACCAAGTCGTCGTGGACGTGAACGGCTGCGCGGCGGTGCTCGTTGCTCCAACGTTCGTGCTGACGAGCGCC
AGTTGTCTCGTTCAAGCGTCGTCGACGGCACGTGTCGACCACATCTTTGCTTCAGGAGGACGAGGCAACACAAGCGTCGAGATTCGGGTATTGACCCAGA
AAGCAGTCATTCATCCGCTGTTTTTCTCGTCGGGTCGGCGTCCAGAATTCGATTTCGCGATCCTGGAATTGGCAGAAAAAGCTTCAAATAGCGCCGTGGT
GCTTTCCTACACAGAAGAAGGCTCATGGCAGGATACGCTAAAGGATCTGCACGAAGACTTGGTCATTTACAGCTCTTACCCGCAGCAGCAGCATGTTCGA
GATGCGCGCCGACAGTCATATCAACTACCAGCTTCCAGTGTTTTTGGTCGAGAAGAAACATGCAATCCAGCGAATGCGACGGTCGTCTGCGCGCAAGTGA
AGAAAAGCTGCCAAGATTTGGCAGAAATTGCTTACAGTACAAACGCGACGAATCCGTCCGTTTCGTTTCTCGGATTTTCAGATACTGCTGCTGGTGAAGC
TGCCGACACAGGTCGCGCGCACATTCTCGGGATGTATCCGATGCTGCCTCCATGCCGAGATGAGACAGATACCAAAGAGGGATTACCATCCTCGACAAAT
CTATTTGTCCCCGTGGCCGCAGCTCGATCATTCATTGACAAGCACAGTGTGGGGCACAACTGGCAGCAACTGGAACCAACCGATGATGCCAGCAGCAGCA
GCAACGGCGGTGAAAACAGCGAATCTCCTCCAACTATAAACCCACTAACCCCATATTGGCACAAAATGGTTCCCCAGCTTGGGTACCTCGTTGGGGACAA
TGCCACCGTGCACGAGGACAAATTCGTTCCGTTTGTGTTGATCGCGCCCAGATTTGGATTGAGTCGAGTGAAGTGGTTTCGTGAAAGTACGCTGGTTATT
GATCCCGATAGCGCAAACCAAACTGTACGTGCGGTTGTTGATGGAGAGTCCATCCTTCTCAAGCGACTGATTTTCGAAACAGCGGCGCACTCGGACCTGC
TGCGCAATAGAAACGGTATTTTAACTGAAAAAGAGGAGCAAAGGATCGATTGGGACTACGATTTGGTGGTC