Description :
From Genome Similarity Track
Location :
Scaffold_991:2150- 3782
Transcript NameFunction/comments
Phyag_g9019hypothetical protein PHYSODRAFT_495612

Sequence
1632 bases(100 bases per row)
TAACTCGACCACTTTGGAATTTGCTCCCGTGGCAGCAAGCAACTCGACGACAACCTCGCTTCGTCCTTCGTCCATCATGCTGAACCTCAGCTCCAAGTCG
ACGTGGGTcaccatggacgacgccaaggcCTCGTTCAacctcttctgctgcgtaTGCGGTATCGGATCGCTCGCTATGCCTTCCAACTACGCTCGTGCCG
GACCCGTCTACGCATCGATCGCTTTGGGATTCATGATCTTTGCCAACACGTACGCAGCTATGAAATTGTCCAAGGCGATGCTGGCGGCTCCGTCCTCGGT
CAAGACGTACGGCGATCTTGGTGAGTGGTCTCTAGGCAAGTGGgggcgcttcttctccgtcatctcACAGATGGGCGTGTGCGTGCTGGTGCCCATTGCC
TTCTTGATTTTGGGTAGTACGCTACTCGACGTATTGTTCCCGGACTCGTTCAGTCAGACGTTCTGGATCATCTTCATGGCGTTGATGGTAACCCCAATTT
GTCTGATTCCGACGTTGAAGGAGAGCGCTGGTATGGCTTTTGCCGGCTGCATGGGTACCATTATTGCCGATGTCATAGctgtgtcgctgctgcagtacaa
tATGCGCGGCCACCCGTCGATTCCGAAGCCCGATGTGTCGCTCCACCAAGTCCTTACGTGTTTCGGCAACTTGGCTCTGGCTTACGGTGCTTCGATTGTG
ATCCCAGATCTGCAGCGCGAACACTCTCAGCCGCAGCGTATGCcgcgtgtggtggtggtaacGATGCTCATCATttcagccttcttcttggccgttGCTA
TCGCTGGTTACACGGCCGGTGGCTGCCAGTTGTCTGGTAACATCTTGTACTCGATCGTGGACACGTCCAACCCGATGGGTGAGGCTCCTCTGGGCTTCAG
TCCCAACCGCGGCGCCGTTGTGATGGCCTACCTCTTCATGCAGATTCACATTTCCATGGCCTTCTCGACGCTCATGATGCCCCCGTTCTACATGGCCGAG
CGGTTAGTGCTGGGAATGCACGAGAACACCCCCATCGTGCGATTCAACCCTGACGCTGACCAGGCCCACATTGACGAGGACCTGGAGTTGCAGGAGAAGT
ACTCATACGTGAAAGCCTCGACGCCTCAGGACTTGTCTAGCCGCCCGGTGTCGGCCTCCAGTCTGTTGGAGAAGTCGGACGGACGGATGTCCCACCTGCG
TGTGGCGCTGGCATTCGGCGAGGAGATCacggaggagcagctccgcGCCCCATACCAGGGCACGAAGAACAAGCTTCGCTACATCACATTACGTCTgtgc
gtcatcgtcgttctGGTCATcatcgcagtcgcagcgcagGATAAATTCTTGGACTTAGAGGATTTCACGGGATCCACGGCGCACACGGTCAATTGCATGA
TCATGCCGCTCCTCATCTACCTGCGTATCTTCTGGAGGAAGATGTCGATGGTCGACAAGGGCgtgtcgatgctggtgatgctCGTGTGTGGCTGCGCCGG
CTTCTACGTCATGATTCACGCGGCCAAGGAGCTCTTCACGCcgtcggacgacgacaccgcGTTCCCGTACTGCGATCTAGAGTTCCAGAATGAACCGTAT
TACATCCGCAACAACACCAGCTAGGCTGCAGC