Description :
From Genome Similarity Track
Location :
Scaffold_1328:215- 3525
Transcript NameFunction/comments
g17668.t1hypothetical protein

Sequence
3310 bases(100 bases per row)
CTGGCTGGAACGGAGGTCCGGGTCCCCCGACGGCAGCCCGACCTCCTAGCCCCCCTGTGCTCTATGCACACTTTAATGCCACCACTGCTAGTGGCGACTC
GAGGCTGATTATTGTCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCACTCCTGGATTCAGGAGCGACGAACAATTTCTTCCGCGCTTCATGC
CTGTCGATCCTACCCGCGGGTGTTCCCGTGCGTGATGTGCCTGGTGATGTCGTTGTCAAGCTTGCGGATGGAAAGCCGTTCCGTGTCGCGCGACGAGAAG
TCTCGTTGCCGTATACGTTCGACGGCTTCTGCAGCAATGACAACTTCATTGTGTTGGAGATGAACTACGCGTTTGACTGTATCCTGGGTATACCATGGCT
GTCCCGGTATCAGCCCCAGATCGACTGGTTAGCCCGGTCAGTCAAACGGCGACGCGACTTCGATGTGAGCGAAGTCTTCACGCACCTCTTGGTGGCACCA
AGAGACTGGCCCCATGTCACAGTCGTGGACGGGACGTTCACGACGCACGTTGTGCGCAGAGCGAGCGATGGCCCTCTCTGCACGACTTGCGCAGTACTGC
TGACTGATGACGACAGCGTCGAACACCCGTCCGGTTACGGGCGCGTGAGGCGAGCGGTTGAGCATCCGCCGCTCCCGCGGACGAGGAACAAGGCGGCGGA
GCGCATGGCGCTCCCAGCGACAAGCCCGACGGTCGAGCAGGGGCTCCCGCGTGTTTACGAGACGGTCGAGCAGGGGCTCCCGTATGATGATGAAGCGGTC
GAGCAGGGGCTCCCGCATGCCAACGAGGCGGTCGAGCAGGGGCTCCCGCATGCCACCAAGACGGTCGAGCAGGGGCTCCCGCATGCCATCAAGACGGTCG
AGCAGGGGCTCCCGTATGATTTCGAGACGGTCGAGCAGGGGCTCCCGTATGATTTCGAGACGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTCGA
GCAGGGGCTCCCGTATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGCATGACTTCGAGGCGGTCGAGCAGGGGCTCCCGTATGACGATACCGCGGTCGAG
CAGGAGCTGCTCCCGCGTATGAGCGGCGCGGTCGAGCATGGCCTCTCGCGCCTAGAGGAGGGTGAAGTATCGTCCGGCGACAGCGAAACATCGGTCTTGA
GCAGGGGATCGAGACGCACGAAGACATCCCGACGGTCGCGGAGACGTTTGAAGCCGCGCCGCAGTCCAGTGGAACTCACGACGCTACCAATCGAGTCGGT
CTGTGCAGTCGAATATGTGGGAGGTGTTCCCAACCACGCTCGAATGATCAAGGTCGCGAGTCCACCTCGCGACGCCAAGTCCATCACGGGCCTGCCAGGT
CTCTCCTGGAAGAGCTTCCTCCGGGATCTCAAGGCTGGTGACATCGAGCAAGTGTGCCTGATCACCGATGCCAACCCAGTGTCTGACGAGACGAACGCAA
TTGCCCATGATGACACGTCGTCGCGCCCGAAAAGCGCTGAACCAAAGTCAGCGCGCGAGGAGCGCTTCGCTGCGCAGTCGTGGGAATCGCTGAAGGCGTC
CGGCAATCCGGTCTACGAGACAGCTCGCGAGTTCGCCGACGTCTTCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAAATT
GACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAG
CCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTCTGTGTGAAGAAGGTTGTCGCATCGTACACGCCTTTAACAAGCTGAACGATGCC
ACCATCCCGGCGCAGACACCGATCCCGCGGAAGGACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCT
ATCAGATCCTCATGAGAGAGAGCGATGTACCTCTCACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAA
CGCCCCAGCCACATTTAATCGCATGGTGTCCCATGTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCT
GAAGAGGGTCTCAGCGCGATCGACGTGCATCTGCGGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTG
TCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTGCTACGTGAGCAAAAACGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACC
ACCATCAAACCCCACTGAGCTGCGTCAGTGGTTGGGCCTCGCTAACTACTTGCACAAGTATACGAAGGGATATGCCGGCTTGATACAGCCACTGTCGTCG
CTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCC
CAGATGACGCGAAACCGTTCCACGTCGTCTGCGACGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCTGCGAACGAGTCGT
GAGTTATCAATCACGACAGATGAAGCCGGCCGAACGCAACTATCCCGTCCACGATAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTG
TACCTGCTCGGAGAACAGACGTTCGCGGTGTACACGGATCACGCATCGCTGCGCACAGCGATGAAGTCTCCACATCTGTCTCAACGCATGGCACGATGGC
TGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACG
AGCGACGCGGGGTCGTCAAGTGATTGACGAAGACGAGGATGACGAAGATCACTGCGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACCCCA
GAAATGTCGCTACGCGAAGAAATCGCCGTTGCGTACAACGACGACGCGGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCC
GCGCGCTGCCGAATAACACGCGCAATCAGATTAACCGATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGC
CATCCCGAAC