Description :
From Genome Similarity Track
Location :
Scaffold_2825:215- 1957
Sequence
1742 bases(100 bases per row)
GAAAGTGCGCGCGCTGAGGAAAAACGTGATAGCTTGGGTCGTTATTTGTTGTGTACATTCACGGAGTGGGATTCAAGAGGTCCGAAATGGTcactcgatg
cagcaggaTTACTTNCTCTGGTGGCTTGGATCACGTCTTGGTGTCTTCGTTCTTGGTCATCAGCTCGGGGACTTCATCAGTGCGACAGCATTGGTCGACA
CTTTGGTTCATCATGGCGTGGTGtcttgcagtggtggtggtttgATCTCTTCTGGGGCTGTAAGCGCATACGTTTTTCGCGGTGGTTGGTTCTTGGGTAG
CTTGGATGGATACTTCGACTCCGCCAAGGTGGGCTGCCTCCCAGGATACATTCCCTGGGGGCATTTCTATCCCCTCGGGGTACCCTCCGTCAAGGAATCG
GCGGCTCGGACTGGGCGCTGTATCTCCATCCTGAGCGCCTCCGTGCCTATGGGCCTATACGCAAGCCGGGCATCTGCTCCTGCGATCTTCAACCAGTCAC
TATCTTTCAAGTGTCTCGCACGCACACCATCCTGGATAATCTTCTTTTCCCACCATATCTTTCTTGATCTGCTGACTGGACGGCTGAGATGGCAGCTGGA
ATTTTCCCAGGTTGCCTCGTGTCACCAGATCACGAACTGCTACATGTTAAACGTGACTGGAATGGTAGCGCGGACAGCCTGGCGAGCGCAGCTCTCCAAC
GTCAGAGAGGACGCGACATTGAGAGTGAAGCGGATCGCCAAGACCTGATCACGTTGAATCGACTCGATGAAATTCTGCTAGTCGGATCCAATGATCCAGT
CGTCCAGATCTCGCCCTTGGCTACTCGGTCCGGTGCTCTATCCAGAACAAACCCTACGGTCATGCAAGAAGAGTTTGTCCGCGGGCTGCGGATCGATCGG
ATCCGAAAGGCACAGGATGAGGAGCGTGGATCTCAAGTATGAAGAAGTACTTGGCAGGAGATGTGGTGAATCTGACGCAAGACGAAGTTAGATCTCTCGG
CAATATTGCGGCAGACTATGAAGTGGATAGCCAGGATCTGTTGCTCTACTGCCCGCCTACCAAGAGATCTGAAGCCGGTCGCGACGGATTGATGAGGCTG
GTTGCACCAGAGACACTACACTAAGACATCCTGCACCATTACCACACCAGTCTGGAAGGGGGTCATCAAGGGATCGGGCGTACCTATCAGCGGATCCGGG
ATCAGTTTCACTGGAGGGGTCTATATCAGAGCGTGCAGGAGTATGTCGGCGGATGTGTTGACTGTGAAACTGGCAAGAGACGGCCAACGATCAGGGGCGA
ATGGCCTGGAAACATCCAAGCTACGTACCTGTTCCAGATCATCGCGATGGATCACATACCGTCGCTACCCAAGTCGTACAAAGAcaacacggagctgctg
attTGGGTCGATCTGTTCACGGGGTACGTGATCGCCAAAGCTAGTGCGTCTTGGACAGCGCAAACGATCGCTGAATTCTATGAAGCGTGTGTCTTCCGGA
GATTTGGAGCAAGTGAGACAATTAGACACGATCGGGAATCCTGATTCATGTCGGACTTCTTCCGGGCGTTTAACAAGATCATCAGGCAGCGTCAGCGAGC
CACAATGGCCTACCGACCTCAGGCTAAAGGCACGGCAGAACAAATGGtacagacgacgacgagagcttTGAAGATGTTAGTTCAGGATCTAGATCAACGG
GATTGGGATGAGTATGCTGAACGACTAACGTTCGCGATCAAC