Description :
From Genome Similarity Track
Location :
Scaffold_2623:215- 1575
Sequence
1360 bases(100 bases per row)
CGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCC
GCAAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAAATCACAAAGGGCCTAG
AGCCCAGAAGGTGAACACGGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTCGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGATCAGCC
GGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGGCCCGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGG
CTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACG
TCCTTCTGAAGGAGGCTCAGCAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCT
TCTGGGATCGGGGCGTCGGCCATGCTGCTATGGTCTTGACCTGGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCGC
TTGTGACGCGAAAACGCACTTGTCGATGTAGGCGTAGAGATTGTTTGCTCGCATTACGTCCAACACTCAACGGAGGTGTCCTAGATGCACCTCCATGGCC
GTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCAAAGGACGTCGGTACGAAGGTGCACAAAGGGCGGAACAGCTGCGTCACCAGGCGATTGA
ACGTCGCCGGGGCATTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGATGAGCTCACCGCGGTGAGCGAGATGTCACTCTCTCG
CATCAGGATCTGGTAGTATCCGTCTACCAAATCCCAGCGCACTGTACAGTACGCTCTCGGCCATGTTGTTTAACAACACATCCTTTCGTGGGATTGGTGT
TTGGGCCGGCACCATCGCGCTGTTCAGCTTGTTATAAGCATGAACTAGACGTCACTTTCCGTTCGGCTTCCGAACACAGAAAGTCGGCGTCGAGTGCGGA
TATTTCGACTCCCGCACCATGCCTGCCTTCCCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGCTCGCGCGGGAGAGGCCATTGCCTCGTGACAC
AATACTTTGTGTCAGGCACGAGATCAATCTCATGCCGTACTCCTCGATCCGGTGGGAGTT