Description :
From Genome Similarity Track
Location :
Scaffold_714:215- 1261
Transcript NameFunction/comments
Hyaar_Emoy2814463hypothetical protein

Sequence
1046 bases(100 bases per row)
TTTTTGCACCTTGTTGGCTTTGCGCTGTTCTTTACTCAGTTCGTCATCAAGTCCGCGTCTTTTCTTCTTTAGTGCTGACAGCTGCTCCTTGGGCGGTGCA
GTAGGCTCGATACCGAAAATGTCTTCCTCCTGCACGCGATCCTCTTCTTCTGGTTTGTCTTTCTGCTCCACTTTCTCAAGCTGTTTTTCTAGCTCATCTA
GCTGGGCCTGCAGTGTATCCCTCTCTTTTCGTAACCGCTTATTGCCAGAACTCATCTTAGAAATATCATCATTCAGCTCTGTGTTTCGCTTGGCCAGCTC
ATTGGCCCGCACAAGCTCAGGATTTTCCATAGCGTAAGTCGCCTGCAGCTTCAGATTTTTCAACATCATTTCATACTTTTCTTTGTCACTTTTCATTTCG
TTGTTCTCTTTCCGCAACTCCATCCGCCTCGCATTAAGGATATCAAACTCACTCGACACAGTACTCCACTTGTGCTGCATACATGTCAGCGAACGCAGCA
ACTTTTTGTTTTCAATTGTCCACATCTCGGTATAGAGCTCTCCTGTCACAAGCACGCGCGTGTACTCCTGCCTTTGCTGCATGTAAGCAGTCGAGTGCCC
GTACCCCGAAGCGACTAAGTCAGTGCTGGCGGTACCATTATTAGCGCTGTCTCCATCCGACTTACGACCGCCATTTTCCTCTACAGTTCCTTTTTTCACG
TCAGCAAACTTGATACGTACTGGCCGAGATGCAGTCTTCAGTTTTGCCACCACCTCCTTATACGTTAATCCTGCCAACGACGCGTCTTCAATGCTGATGA
CACGCATACCAATCGTCAGACGTTTGTTCGCCTTAACACTCCAATTGTGTAGCTCGGCGGGACCTGCTTTCCCATTGACTTTCGGCAGATCATCCACTTC
AGCTTGGAATTGCGGGTACAAAATAGTCTCCATCTGATGAACCTCCCTTAGACTCACACCCAGTCGACCTTCCTGGAAACAGATCTCCACCTCACTCAGC
CAGTTGTATGTTTTCTTTATCTTCACACTCGGAGTTTTAGCTGAGG