Description :
From Genome Similarity Track
Location :
Scaffold_1169:215- 1235
Transcript NameFunction/comments
g14363.t1hypothetical protein

Sequence
1020 bases(100 bases per row)
AACTCTGCGCGATTGGCTATTATAATGCGTAGTGTGGACTACACCACATCGGAATTAGCGGACTGAAATCACTGATGCTGATTGGACAAAATAAACCGCC
TTTCAACAACGCTTCTTTTCCATTCCCATACGTGGTCGAGTTCAGTGGAGATATCCAGGCCGAATTCTGCCAACCGGTGTGGAAGGGCGGCTCGGCGACA
GAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTG
ATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGCGAGGGGAGACACGAGGTACACAATGATCTGGGGAATGACTACATTAAGAT
TCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGAC
GAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCA
ACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGT
GCTCGACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGTGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGG
TTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCC
CGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAATTTCCTATCCAGACTGCCTTTGCCATGACGATCAA
CAAGGCGCAGGGACAAACGG