Description :
From Genome Similarity Track
Location :
Scaffold_186:21481- 23846
Transcript NameFunction/comments
Aphas_H257_18659ABC transporter

Sequence
2365 bases(100 bases per row)
ATTGGCTGAATTATGGTATTTTTGGCGAATCAAATCGTGAGGTGGATTTATTGCCACTTCACGTATTAATAACAGCAAATTTCACCGAAATCCACAATAC
ACGTACAGTAGGCACTATCATTATCGACCAGAATACATTAGTATGGCTTAAGAGCAGAGTTCACAAAGTCAATGTGTAGGTACATAATGTCGATTCCATA
GGCTAAAATACACGTTCAAAGCAACCAATCAAACATCGCGACCATGAGTACTTCACTGCCCCGAACTACAGTTCAACCTGTTCTCCGTCCGCCAAGCGTC
GGACGACAATATCACAGTCCGGTTTCCGGCTAAATATGTGAGATTACCACCTCCTTTGGAGACGTGCTTAATGCAGCCACGAGCTGACGGAGGAGGACTG
GAAGGTTTTCTTCCTTGGTGCCAAGGACTGTGATTCTGTAGACATGTCCAAGTTGGACGCCGCGATGGCCAAGCTCAAAATGGACACGACAGTGCAGTCG
GCGGAGTCCCGGGTGTCCAAATTGGTTTCGAGGCGGTACTCGTACGCCTCTCAATGGTAGGGTTTGCGGAGGCCGAGCCAAAACTAACTGTCGACTATCT
CGTCGCGGCCGTCCAGCCACTGGCCGTGCGCGCCCGTGTCAAGGAACTCATGAAGTTGAACGAGAACCGCAGCCTCAAGAAGGACGCGCGCGATTTCAAG
CGCTGGCCGGCGGACTGCGTCGCTACGGCGAGTTCGATGGCCGCGGCGGTACCCGCCACCGCCAAGCCCGACAAGTTGCCCGCGGCGACCAAGACCCCCA
AGACTGGGAAGGCCCCCAAGGTCGTGGCCGTCGTGAAAGAAGACAAGATCCCGTAGTCGAACTTCACCCAAGAGAAACGTGCGTGTTTCAAGTGCCTGAG
CACCGAGCACAATGTGTTCAAGTGCCCTAAGGTCGCTGACGGCGAAGCCAAGCTCTTGATGGAACGTGTCCGTTCCATCTGGAAAGAAACCAAGTCGGTA
ACCGTCGTCGAGACGGTTGACGTTGCCGAGGTGTCCCTCGACAATGCCGTGATTTGCGCTGCCCGCGTTGTGTGTGTGGCTGGTCAGGCCGTCTCGCTGG
ACGCGTCCTTCGACAGCAGCGCCGATCAAAGTGTGGTGCATCCCGCGACGCTGGCCAAACTCAAAAAGCAAGGCCGCAACGTCCTCGTGACCAAGCTCAA
GACCCCCATTAAGGTAATGGTTTTTGTTGGCCCTGCCCACACCGTCACCGAGGAAGCCACGATGGACCTGCGGTTCGAGAAGGACGCTGGCCCGGTGATG
CTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN