Description :
From Genome Similarity Track
Location :
Scaffold_2285:2148- 3580
Transcript NameFunction/comments
Phyag_g12299hypothetical protein

Sequence
1432 bases(100 bases per row)
AACACGAATGACTGGTGTACAACGAAACGGTAAGGTTTTGGTAGTTACGGGACGCAGACTAAATCGATGATGTTGTTTGTGTGTGCGGGCGCTGAATCCA
CGATGCGGCCTGccgcttgaagctgttgatagCAGCGGATGTGGTCGTTGAGATGGCCACTTGTGTGCAGCTTGCGCATGGACTTCAAGACGCTTTGAGC
CCCACGAGCGGTGATTTTGCGTTCGCGGAAAAAGGATAGCAGCTCTGCCTCGGCTGCTTTTCCGACCTCCAACGCTTGGTCTAGGTACTACGCGGCCTTA
TCTTCCAAGTTGAATCCGTTGGGgatgaagagcttcatgAACGCGACGACCAGCTTAGAGGTGGATCAAGTGTGTTTCGTCGAATTGTCGGTCGAGTTTC
ACATGCGAGGCGATTGCGTATACCACGTGAACCAGGCCTCTTTCAAGCTGGAAGCTCTAGAGGTACGTCGTCGCATTGCTGGCGGTGTGTTGCTTGTATC
CTCACTTTTGGTttgcgctggtggtgcccgtTCGCAATTGTTGTAGACTTTGGCCTCCATCGAAGTTATCCGCGTGTCAAGCTTCTGGTTGACTTGGATT
AACTGCTCAATCAAGGCTGCGTGGTGACGAAACATTGGATGTTCGGTGATGTCTGTCGCGGCCGCTGTGATGTGTGTGTTCGCTGTGATGCTTGGTGTGC
CTGTGTCACAGGCTGGGTGCGATGACCACGCCAGAAGCTCGCTCATGGTGATGGCTTTCTCCAACACGCAAGCTTCGATCCGTTGAACAGCAAGTTCGTT
AGCATTCGCTCGCTTCAATGCCGGGTAGTGGCGTAACAGATACGCCATGAGAGTGTCGAGCACGCGTGCATTGATGTTGAACGATGGCATCTTCAGACCT
AACGAAGACCAGAAAAGCGACGACGCAACGCCTCGGATCTTTACTTGCGTATCGGAGTCGAAGCTATTCAGCGCTAGCAGATGGACGGGCCTCTCGGCAT
CATGGCTACTCGAGACTCTTCCGAGTTTGTGGTCCTCTGCCGGAGTATCGAAGACGTAAGCAAAGGCCTTGTTCGTCGCCGTCATGTTCCACGCCCCTCT
ATCGAAGGTCCACTGGACCCACATGCCTGCTCCGTTCGCGTGTTGAGCCCCTCCACGGCGAAACGAATGGGACGTCAACTTCTCAGCAACCCCTGATTTA
GCGACGACTCGATCAAGGACACGATTCACGTAGCTGCGGATACCGGGTAATGCGCCGGCGCTTTCACTTTGTTGCCGGACGCACCCTGTTGAGCCACAGC
TTCCGAATGGTCGATCAAGTCGAGTAATGGAGTTGCCGGTGTGAATATAGCGTGAGACTtgaactgctgctcaggGTGTTGgctcagcagcgacaccgtc
GGAGACTGCTGGATGATTAACGCAAGAGCGAT