Description :
From Genome Similarity Track
Location :
scaffold_139:21473- 23359
Transcript NameFunction/comments
Pl_108898hypothetical protein PHYSODRAFT_556294
Pl_108899conserved hypothetical protein

Sequence
1886 bases(100 bases per row)
TTTCTCGGGAAAACATTTGCGCATGGGACGGACAAGGCTCGCATTGCCGACGACGAGCAGTGATGTTAACGTGGAGGTGAGCAGCAGACGAGATACAAGT
ATAATGACTATATCATCACATGGAAGCGTTTTCCATTTGCGTTCCTTTGAAATTTGCACGACTAATTAGAATTATCAAACATTCGACAGTGCTACTCATC
CATAACCGCATCCTCATCTTCATTTTCCTCTCCATCGGCATCGTCGTCCTCATCGTCGCCTTCCATATCTTCTTCGTCGTCGTCGACACCTTCTTCATCA
TCATCTTCATCATCATCTTCCTCGCCCAAATCAGCATCTTCGTCATCGTCATTTTCATCATCATTTACGTTCTGATCATAATGGCAACGACGTGGGCCAT
CTAAAACGTTACAATTTTCTTCGTCGTGGAAGTCGCCGCGGAAGGTACTACAGACTCGTAGTTTACCCTGTTTAGTGCCATATAGGAAGCCACCACCGCA
AATCGGACTGAATAATGCAATATTTACATCGTCCATTGCGCTCTCCACATGGGACAGTAGCGCCATATCTTCCCATCGATATATCCGAGTTACTCGATGA
ACTGGGAACTCCGTTTCGCTACCAAAATTAACAGAGGAAGTTAGTGCACAACAGGAGCAGGAACTATCGCAATACTTGATGACTTACCGTTGTATACGGT
CTCGTACACCGTAGCCAAGCAATACATAAGCTGATGTTGGTGAGATTTTAACCGAAGTAACGCCACCTGCCGCAGTCTCGGCTAAGTGGCAAGTCTGGAT
GACACGACCAAGCTGCTCAGGATCCAAGGATATCAAAGCTAACCACGTAGACTGGTTCTCTGACGATAATCGTCCTCGACGGTTGCGCTGGTTTCTAGTG
AACCGTGTCCGACTAAGCGCAATGTTTGGCCGAATTTGTGAATATCTTTGTTGGGGGACGGCTGCAGGAGCTGCGGTGCTCCGTGCTGGCTCCATTGCTG
CTGTATAACGCTGAATGCTATGCGGTGGATGTAATCGGGGTCTCACGCGTCGTATCTGCTGGTTCATATACTGATCCATTGTAAGAGATAAGTCTGCAGC
AGCTGATTGCAGAGCTGCTAGCATATTTGGGGCACCCGTGTGCATACCAGAAATTGGCACTAGCCGTGGTGGCGGCGGGTGAATGGGGAGGGACAGCGGC
ATTGTCGCCGGTAGCGCTTGCGGAGCTACGCCATTGCCTCTTGTTGTCCGCGCTGCCATGCCGGATGAAGAGCTACTCTCATTCGACGCTGTGGCTTGTG
GGTCTGAAACGGACACGTCATTAACATCGTCACTAGGGCTCGTTGCACCACCACTTGTTGTCTCTTGTGTTGCTGGCACCGAGGATAATATAGTCTCCAA
ATCTGTGGTAGCTTCGTTCTCTGCTTCCATCTCCACCTCTTTCTCAGCTTGCCGAAGTGAAAAATCTGCACATATCGCCAAGTACCGCCCACAGCGCGAA
ATATCGAAGCCGCCATCGTTGTAGATGAGAGCATGCGAAAGAATTACGCGGCTGTTGTTCATTGCCTTCTTCGTCAACAGAGGCTCCGGCGATAATGCCC
ATGACGGATCGAAGTCCCACATAGTCAATGTGACGGTGAGGTCTGAAGGTGGGGCTTGCCCTTGCGGTCTCTACCAGAGCAAAATCAAGAACAACGTTAT
TGACGGGGTGCAAAGCAAAAATACGGAAACAACGTACCACATAGCGTTCATTTGCTTCTCCGACCATGATCTTAGATGGGTCCGGCAAGAACGTGACAGA
GCGTAATGTTTGGTAGCTGAACATTGCAATGCGCGGACATGTGTGCTAGAACATAAAATGATGCATGTCAGCCTTTACGTGTAAAT