Description :
From Genome Similarity Track
Location :
Scaffold_46:214723- 216083
Transcript NameFunction/comments
Hyaar_Emoy2806127oxidoreductase

Sequence
1360 bases(100 bases per row)
TTCGGGCTGAACTTGGATTGAAGACATCCGGTGATTTGTGGAGAGGCTTAGCAGACTGGCGTTGACTTGGGTCTCGTGTCCGAAACAGGTAGCCGTTGTT
GGCCTCTTCTGACGCAGCTTTTTGTTTTCTACAGATCGCCAGGAGCTTATCTTCCTTCTTGTCTCGCTGCTATTGATGCTGTGTCTGGGTGTCTGGACAG
TTACAACCTCGGTGCGAGCAAGCAGGCGACTACAAAGTCGTGGATACCTGCTTGACACCCGAGTACGCACAATGTCGGGATGGTGAGGTTGTAGACCAAC
TCGATCTTGTGTGCTGCATGCCAGAAAGCCTTGGGCCGCGGAGGGTAGATGTGATAGATGTCGTTGCCCGAAAGCGAGAGATCGCCGTCTGCAACCAGCT
TGATCCACAGCTGGGAGAAGCTATGAGGATGGACAAGCACATAGGAAATGGGGAGATACATCAGCACGCATGCTTTATCCAACCAGCAACTAGTAGCAGC
AGTTCACTCACAGCAGAATAGGAGCAGTCATCCAGATCCGCACAAGTGGCAGGTAGCAGAAGACGAGTGCGAGCGGCACGCCCATGTGCAGCAGGAGGTC
GATCGAGTTGGCCAGTAGTTGAAAAGACCCGTACTTGCTGATGGCACCAAACCAGCCTTGCAGGATGCCCATGAACGTTGTTCGGTCAAACACTCGGAGC
GAGTACCAGCCCATCATGATCGTAAAGCCTAACGACGTAGCGAGGCCTAGCGCTGCCTTCGACTCCGTCACATGCGCCAGTACCGTGAAGATCGTCCAGC
AAAAGGTGTAGAGGACTCGCACGCGCACGACCACGGGCAGCAGCGCCACGGAGAAAAGCATCAGGACTGCCAGGACTGCATCTGTGCTCAATATGGTGGA
CGAAGGGACGTGCTGCTCGCTATCGCGGACTCGAAGGACTGTGCGGGTCAGCGTATCGTGTGCAATCGTGAGGAAATAAAGAGTGTCCATTGAAGAGCTA
CGATATGAGCGTTCGAAAGTAGAATGAGCTCGAGAGATGGTCAGAAAATGCGTCTGGTCAAGTGGCGAGACCGCAGCGTTCCGCCTATAAATAGCCGCGA
GGGTAAGCGCGGCCGCTACGATGGTTTCGGTCGATTGCTGATTTGTACGGACAGAGCGATGCTTGTCTATGTACATGCCGCCTCGTTTTTGCACAAGTGG
GATGTAAAGTGTGTGTAGCGCGTCAGGGTGTTGTCGGAAATATGTGTTAATCTGCAGTTGCTATACTGTATATGACACTTAGCTGCTTACGATGCATCGT
CTGACGGTACGGAAGAGCTTAGCCATACTTAAAAGACCATTATTGCCCTCAAAACACGAA