Description :
From Genome Similarity Track
Location :
Scaffold_481:21464- 22562
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_481-snap-gene-0.12Conserved gene of unknown function

Sequence
1098 bases(100 bases per row)
ATGCCGACGCTGAGCGAGGACGAGCAGGCGCTCATCCAGAAGGACCGCGAGGAGAACCCCGGTGCGCTCGTGCTGCTAGTCTGTCGGGTCTGGTGACTGC
AGCGCGTACTGATTGAACTGAGCACTGTACACGCGTGTTCGCTTCATAATCGCGACACAGGCTGCTTCTACTCGACGGCGCTCTCGCAGTCATGCCGCTC
GATCAATGGCGACAGCAAGTGCGAGATCGTCAAAAAAATCTTTCGTCAGTGTCCCGGCAAGGGAAAGGTGCTGTGACCAGGGTTGTTATAGCGTAGTGGC
TGGATGTATGTGCCAGAACTGTTGACAAACGGTTTTCATTACCAGGAGCTCATCTCGAACCGGAAGGAGGTAACGGAGGACGAACACGGCGGCGAAGCGG
CGGCCGGCGACTTTTTCAACCGCGAACGGATGGATCCTCGCAAAGGGTAGGTGCTTGATGGACGCCGTGCCGTTGAGGGAAGAGGTAACTAATTGCTCGA
TGAACTGTCAGCGACAGCGAGTTTGGCGGCTCATTCAATCCATTCGGGCACAGGTATGCTCGTGTTCGAGTGTGGAGGATGCCGTTCAGGGATGAACGAT
CGACGTGTTGAGCAGGGAAGACGACTTTGAAGCCCAACTGAGCCCGTTCGACTTTCTGCGGCAAGAAATGCTGCGGCCATTTGAAGGTGACAAGAGCGTT
CGTTGCCGTGACTCAATTAGCGTAACGTCTGTGACTTACAAATAATCACTCAACCTTTGCCAGGCTTTTTCGGTGGCGGCATCTTCGGCGGTGGGGACTC
GAACCCGTTTGAAGGACTGGAAGGCGAGTTTGAGCGCATGCCGTTCCAGCCGCCGTCTTCAATGCCTCGTCGATCAGCGAATCAGCCGCCGCCAAATCCG
CCGCACTATTCGTTCCACCCCGCACAGGGACGAAATGCGAAAGGTTCGCAGCAGACCGTGATTTCTTGTCCTCGTTGGGTTGGTGCACTGTGCTCATTTG
GATGACTGTTGCGTTGTCAGAGCCGAATTCCAAGGCCAAGGCAGAGGAGAAGAAGGACATTTTTGCAGGGTATTCGGGTCGCGTTGAAGAAATTTGAT