Description :
From Genome Similarity Track
Location :
contig_53:214633- 216290
Transcript NameFunction/comments
g10348.t1hypothetical protein
g10349.t1hypothetical protein

Sequence
1657 bases(100 bases per row)
CCTCGAAGGACCAGTGGCCTTTCACGAGCCCCGGCTTGAGCACTTTGTTCCAGCGCTGTAGACACTGTGCGTGGTTGCGGCCGTCCACACGGGAGGCGAT
GGCCTTCCAGTTACGCTGGCCGAACTCGTCCACCGCTCTGCGCAGCGCGTCATCCTGCCCGGGCGTCCAGCGCTTGCCCTTCTCCTCCTCTGCGCGGGGC
TTCTGCGCATCACTCGGCACCTCGTGGAACGAGCGCAACGCGTCATCGCTCGCGTCGCGCTCGCGCTTGCTGCACAAAAAATAAATAGGGTTCGCACACA
TAAGAATGGGTCCGCACACACAAGAAAGTGCTGCGCGCGGAGCTACGCACAGTGCAGCGTCCGCTGCGTGATCGTGACAGCAGCAAGGCAAAACAGGTCA
GAACACGTCACTGGGGGCAAAGTGGGCACAGGGAGCGCACCCATAGTAGAGATCGAGAGCTGTAGGTTGCAACGCGCTGCCTGGCGCTGGTGACAGAGTG
CGAGGGGCGGCGCACTCAGCGGTCGACTTGTTCAGGACCGCGCCGGGTTGCTTATGATGACCCCCCCAGCAGATGCCGAGAAAAACACGACTTTCGACCA
ATCAGCGCGCGGTCAGGACCTGCGGAACTTCAAGTTGACTCGTGCTTGTGTAGTGTGTACACTTTGCCGGTGTTTGTCGTGGGCTTGTGTGCTGTGCAAC
TCGTGTGCTGTGCAATCCGCGGCGGGGTTGAAGTTCGACTGGCCCGACCAGATCGGTGCTGGGCTTTGTGGCCGTGCCGAGTGAAATGCGGCGTCCGTCA
TGGCGAGATTTGGCGTCGGTCTTGCGAGCGCCTTGGGCATATGCAGGCTTGACAACACGCCAGTGCTTTCCATCTTAGAGTTTTATTGTTATGTGGCATG
TAGGCAACGTTACTCGGCGGCACCGAAAGTTCAGCTTTGCACGTCGTCACCAAGCACCACTGGCGAGTGTGACCAGCCGCATTCAAACGCGAGCCCAGCA
GAACATAGTCGTTGCCACGACAACGACGTCGCTTCCGCGGTGGACTTGGCACTCCATGTTCTACCGCAGACTACGGCGTTGTCGAGCCTCGTTTCCTAAT
GCCGGGTATCGTCGGTGTTAACTGCATAAGTGCTCGCACAGTAGTGGAAGTCTCGCCAACGCTGGCGGTCCCCACGATGAGGACCCCACGATGAGGACGA
CCCTTTCTGTCGCTGCGACTCGATGACGACGGAGGCGTCGAGGCAAATGCGTGGCACCACTGGCGGGCTGTGCCTTCGAATCGTGGGCGGTCTCACATCA
TTCGTTTGTAACGAATGCTGTGCAACTTCAGAAACCTCTGCATAACTGATATAACGTCAGTCGAAATCGAAGCCCTCCTCTCTTTTATACATGTATGTAC
TCTATGTCCGCATGCCCCGTTAAATCCGGTACATGTATCTATATGGTGCGTCATTGTGTATCATCTCCAGCAGCCCCCTCTTGGAGAACTCACTCTGCCA
TGCTGTCGACTAGTAGCGCTGCTGCAATTCCTCGCGCCGTGGACACTCCGTCCAAGAAGGTTGTGCAGACTATCGATGGCCAGAGAATCGTCCGCGTGTG
CGACGCCCGTCTGGCCTACGGCGATATCGTGGGCGACGAGAGCTTGGGCGGACGATT